Thursday, December 26, 2024
Subscribe
Home Blog Page 19

Whole Plasmid PCR-PDF

zhourui
-
0

Overview

It is imperative to use 5′-phosphorylated primers if the nicked DNA is going to be repaired downstream with ligase. PCR should be limited to templates of about 5 kb, but the protocol could probably be pushed up to 10 kb. See the PfuUltra II fusion manual. Primers should be sense-antisense pairs. Optimal amplification occurs with 30-35 b primers at 0.5 μM final concentration. At higher concentrations, the primers bind to each other, inhibiting amplification. For longer primers, the annealing temperature will need to be adjusted from the one mentioned in this protocol.

Materials

For a 50 μL WP-PCR reaction:

  • 37 μL H2O
  • 5 μL 10X PFU Ultra PCR buffer
  • 5 μL 10 μM sense/antisense primer mix (0.5 μM final, each)
  • 1 μL 12.5 mM (each) dNTP mix (0.25 mM final)
  • 1 μL 5 nM plasmid template (0.1 nM final)
  • 1 μL PfuUltra II fusion HS DNA polymerase

Procedure

  1. In a PCR tube, add the components on ice in the order they are listed above. Mix gently and spin.
  2. Perform the following thermocycling program:
    1. Initial melting: 95 °C 2 min
    2. Melting: 95 °C 20 s
    3. Annealing: Ta °C 20 s, where Ta = Tm – 5 °C
    4. Elongation: 72 °C 2 min / kb template
    5. Repeat steps 2-4 a total of 30 times
    6. Final elongation: 72 °C 30 min
    7. 12-16 °C hold

 

Probe Prep, 32P End-Labeled Probes-PDF

zhourui
-
0

Phosphatase Treatment

Optional: Treat probe DNA (synthetic oligo) with Antarctic Phosphatase to dephosphorylate the 5’-ends. Dephosphorylating probe prior to end labeling increases specific activity. This step is usually not necessary for a synthetic oligo unless you ordered it with a 5´-phosphate or have phosphorylated it enzymatically.

  1. Combine:
    • 1 μL of 10x Antarctic Phosphatase reaction buffer
    • 1 μg of probe DNA
    • 1 μL (5 units) of Antarctic Phosphatase
    • H2O to 10 μL total volume
  2. Incubate15 min at 37°C (for 5’ overhang)
  3. Heat inactivate 5 min at 65°C
  4. Can scale reaction up and store a stock of dephosphorylated probes at –20°C. Label aliquots as needed.

End-Labeling

γ-ATP label 5’ ends with Polynucleotide Kinase

For phosphatase-treated ladder (forward reaction)

  1. Combine:
    • 5 μl of 10x T4 Polynucleotide Kinase reaction buffer
    • 10 μL (1 μg) of dephosphorylated DNA probe
    • 32 μL of H2O to 50 μL total volume
    • 1 μL of γ-32P ATP (6000 Ci/mmole, 10 mCi/mL)
    • 2 μL (20 units) of Polynucleotide Kinase
  2. Incubate 30 min at 37°C
  3. Heat inactivate 20 min at 65°C

For untreated ladder (exchange reaction)

  1. Combine:
    • 5 μl of 10x T4 Polynucleotide Kinase reaction buffer
    • 1 μg of DNA Probe
    • 100 μM ADP
    • H2O to 50 μL total volume
    • 1 μL of γ-32P ATP (6000 Ci/mmole, 10 mCi/mL)
    • 2 μL (20 units) of Polynucleotide Kinase
  2. Incubate 30 min at 37°C
  3. Heat inactivate 20 min at 65°C

NOTES: Fresh buffer required for optimal T4 PNK activity. Alternate phosphate donors possible, see NEB. Higher level of incorporation can be achieved for the exchange reaction in alternate buffer, see Molecular Cloning.

Removal of free ATP with sephadex spin column

probe must be >10nt. Sample volume = 25-50 μL

    • Vortex column gently to resuspend resin
    • Loosen cap 1/4 turn and snap off bottom closure
    • Place column in 1.7 mL Eppendorf tube
    • Pre-spin column 1 min at 2.8x1000rpm in sorvall biofuge pico. Discard eluted buffer and tube.
    • Place column in new 1.7mL tube. Slowly apply sample (25-50uL) to center of angled resin surface. (Don’t disturb resin. Don’t place sample on the side of the column.)
    • Spin column 2 min at 2.8x1000rpm. Purified sample is collected in the support tube.
    • Discard column after use in solid radioactive waste container.
    • Store labeled probe in compliance with Radiation Safety guidelines

Restriction Digest-PDF

zhourui
-
0

Overview

This protocol is typically used to do bio-brick digests with the restriction sites consisting of the following configuration:

—–EcoRI–XbaI–Part–SpeI–PstI—–

See the biobrick assembly schedule for more information on using this technique.

Materials

  • Prepared DNA from miniprep, PCR, or Gel Extraction
  • Restriction Endonucleases
    • With corresponding 10X buffer. NEBuffer 2 can be used for most applications.
  • BSA
  • Antarctic Phosphatase
  • Distilled water

Procedure

1. Quickly vortex all ingredients (Buffer, BSA, DNA) before beginning. 2. Add the following in a micro-centrifuge tube:

  • 5μl of Buffer (usually NEBuffer 2);
  • 1μl of BSA;
  • 0.5 picomoles DNA normally uses 10μL of miniprep or 5μL of purified PCR product.
  • Water to make 48μl.

3. Vortex Enzymes and add 1μl of each to the tube.

  • If you’re digesting purified PCR product (i.e. “insert”), add 1μl of DpnI to the reaction.

4. Incubate reaction in a 37°C water bath for at least one hour.

  • If your digesting a “vector”, add 1μl Antarctic Phosphatase and 6μl of Phosphatase buffer after 2 hours of incubation and incubate for another hour.

5. Heat kill the digests for 20 minutes at 80°C. 6. Store digested DNA in the refrigerator (4°C)for use in the very near future.

Notes

Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!

  • DpnI eliminates the background from your PCR template
  • Antarctic Phosphatase eliminates background from the vector self ligating.
  • If you’re not getting good digestion it might be because your enzyme is bad. Double the digestion time and see.
  • Longer digest gives more complete digestion, especially if you have >1µg of DNA, but can sometimes give nonspecific digestion
  • Beware the the NEB double digest chart. For EcoRI and PstI double digest it recommends using the EcoRI NEBuffer. However based on my digests both NEBuffer 2 and 3 work better; with NEBuffer 2 giving the most complete double digestion. It is funny that they recommend the EcoRI buffer because their chart also says that PstI is only 50% active in that buffer.

 

Amplified insert assembly-PDF

zhourui
-
0

Overview

This is a lab specific protocol. For more information on the benefits of Amplified Insert Assembly see the consensus protocol. A You-Tube video summary of the Amplified Insert Assembly method provides a quick and entertaining visual introduction.

This protocol is typically used to do bio-brick assembly with restriction sites consisting of the following configuration:

—–EcoRI–XbaI–Part–SpeI–PstI—–

Ocassionally other enzymes (e.g. BamHI or HindIII) are used to make protein fusions. See our bio-brick format page for more details.

The two parts you want to assemble will be labeled “insert” and “vector” and will be initially contained on separate plasmids. The eventual goal of assembly is to get these parts on the same plasmid next to one another.

Procedure

1. Miniprep both “insert” and “vector” from their respective cultures using a kit or this protocol (30 mins).
2. PCR the “insert” plasmid (This will take about 2 hrs, but start the vector digest right away while the insert PCR is cycling).

  • Use a high-fidelity polymerase (e.g. pfu Turbo or Vent).
  • Use the same primers you use for colony PCR (Annealing Temp of 55-60°C).
  • Only run 25-30 cycles as this will help ensure high fidelity.

3. Start Digesting the “vector” while the PCR is cycling.

  • For help on deciding which enzymes to use see this page.

4. Purify the PCR product using a kit or this protocol.
5. Digest insert for 1 hour (adding DpnI along with the other restriction endonucleases).
6. Once the insert is digesting add 1μL Antarctic Phosphatase and 6μL AP Buffer to the “vector” digest and incubate until the “insert” digest is done.
7. Kill all reactions by incubating for 20 mins at 80°C.
8. Ligate at a molar ratio of 4:1 (insert:vector).
9. Transform.
10. Plate on plates with the same antibiotic as the “vector” resistance.
11. Celebrate.

  • If you already have PCR insert ready to go (i.e. you ran the PCR the night before from old miniprep) then it only takes about 4 hours.

Notes

  • The DpnI eliminates any background from the insert PCR.
  • The phosphatase eliminates any background vector.
  • The “vector” will be digested for a total of thee hours (including nearly one hour with Antarctic Phosphatase)
  • The “insert” will only be digested for one hour. This is okay as there is a lot of it.
  • Detractors of this method may say that it’s risky to PCR the inserts because of mutations. We say:
  1. This hasn’t been a problem for us.
  2. This is why we use a high-fidelity polymerase
  3. We’re sequencing the constructs anyway so we’d spot any mutations.

References

 

Miniprep for vaccinia virus DNA isolation-PDF

zhourui
-
0

Overview

This protocol is to isolate vaccinia virus DNA from one 10cm dish of infected cells.

Materials

Solutions

  • 1X PBS, 4°C
  • 10% Triton X-100
  • β-mercaptoethanol
  • 250 mM EDTA, pH 8.0
  • Proteinase K (10 mg/mL)
  • 3.0 M NaCl
  • 10% SDS
  • Phenol:chloroform
  • EtOH, 100% and 70%
  • 3M NaAcetate
  • TRIS-EDTA

Equipment

  • Rubber policeman
  • 15 mL Falcon tubes
  • Eppendorf tubes
  • Vortex
  • Centrifuge

Procedure

  1. Scrape cells from the plate, using a rubber policeman if necessary.
  2. Transfer cells to a 15 mL Falcon tube and centrifuge at 900g x 10 minutes at 4°C.
  3. Wash pellet once with 1X PBS (4°C), and repeat step 2.
  4. Resuspend pellet in 600 μL of PBS and transfer to a 1.5 mL Eppendorf tube.
  5. To each sample add:
    1. 30 μL 10% triton X-100
    2. 1.5 μL β-mercaptoethanol
    3. 48 μL 250 mM EDTA (pH 8.0)
  6. Vortex, then incubate on ice 10 minutes while vortexing occassionally (~ every 3 minutes).
  7. Centrifuge at 700g x 2.5 minutes to remove cellular material.
  8. Transfer supernatant to a new Eppendorf tube and centrifuge at 16.1K x g for 10 minutes to pellet the viral cores.
  9. Aspirate supernatant and gently resuspend the pellet in 100 μL Tris-EDTA, pH 8.0.
  10. To each sample add:
    1. 1.5 μL proteinase K (10 mg/mL)
    2. 6.7 μL 3 M NaCl
    3. 10 μL 10% SDS
    4. 0.3 μL β-mercaptoethanol
  11. Mix gently by flicking the tube, and incubate at 55°C for 30 minutes, flicking occasionally (~ every 10 minutes)

Do NOT vortex samples at any point after this line.

  1. Extract DNA twice with an equal volume of phenol:chloroform.
  2. Precipitate DNA with 10% volume Na Acetate and 2.5 volumes of 100% EtOH.
  3. Resuspend pellet in 100 μL Tris-EDTA and repeat the DNA precipitation.
  4. Wash pellet with 70% EtOH 3x, air dry, then resuspend in 20 μL Tris-EDTA.

References

Relevant papers and books

  1. Esposito J, Condit R, Obijeski J. (1981) – J Virol Methods. 1981 Feb;2(3) 175-9. PMID 6268651

 

 

Making a long term stock of bacteria-S2-PDF

zhourui
-
0
Making a long term stock of bacteria-S2-PDF

Introduction

Whenever you successfully transform a bacterial culture with a plasmid or whenever you obtain a new bacterial strain you will want to make a long-term stock of that bacteria. Bacteria can be stored for months and years if they are stored at -80C and in a high percentage of glycerol.

Materials

  • 40% glycerol solution
  • Day/overnight culture
  • Cryogenic vials/1.5mL microfuge tube

Method

  1. Pick a single colony of the clone off a plate and grow overnight in the appropriate selectable liquid medium (3-5ml).
  2. Add 0.5 ml of 40% glycerol in H2O to a cryogenic vial.
  3. Add 0,5 ml sample from the culture of bacteria to be stored.
  4. Gently vortex the cryogenic vial to ensure the culture and glycerol is well-mixed.
    • Alternatively, pipet to mix.
  5. On the side of the vial list all relevant information – part, vector, strain, date, researcher, etc.
  6. Freeze glycerol stock in liquid nitrogen and store it in a -80C freezer.
    • This will also be a good time to record the strain information and record the location.

Notes

  • While it is possible to make a long-term stock from cells in the stationary phase, ideally your culture should be in logarithmic growth phase.
  • Certain antibiotics in the medium should be removed first as they are supposedly toxic over time, ex)Tetracycline. To do this, spin the culture down and resuspend it in same volume of straight LB medium.

Preparing chemically competent cells (Inoue)-S2-PDF

zhourui
-
0
Preparing chemically competent cells (Inoue)-S2-PDF

Materials

  • Plate of cells streaked for single colonies
  • SOB
  • Ice
  • TB buffer
  • DMSO
  • Dry Ice (or liquid nitrogen)

Glassware & equipment

  • 2 liter Erlenmeyer flask (no detergent residue, rinse with 70% ethanol and DI water)
  • 220 ml conical centrifuge tubes BD 35 2075
  • Eppendorf 5410R refrigerated centrifuge with conical adapters

Preparation

  1. Pick 10 – 12 large single colonies (2-3 mm dia) from your source plate and inoculate 500 ml of sterile SOB medium (do not use LB) in a 2 liter flask. Save some medium as an OD blank.
  2. Grow to an OD of 0.6 with vigorous shaking (200-250 rpm) at 18 degrees (important). This is slow — approximately 35-40 hours.
  3. Prechill the centrifuge to 4 degrees
  4. Remove from the incubator and place on ice for 10 minutes
  5. Transfer to two 220 ml centrifuge tubes and spin at 3220 x g for 10 minutes at 4 degrees
  6. Drain the medium and resuspend each pellet first in 5 ml of ice cold TB. Add an additional 75 ml of cold TB buffer and resuspend.
  7. Place on ice for 10 minutes
  8. Spin down as above.
  9. While spinning, add 1.4 ml of DMSO to 18.6 ml of TB (7% DMSO mixture)
  10. Resuspend each pellet in 20 ml of cold TB-DMSO mixture
  11. Incubate on ice for 10 minutes
  12. Dispense cells into pre-chilled tubes
  13. Freeze cells in a dry ice / ethanol bath and store at -80 degrees indefinitely

Thoughts on improvements

  • “Methods in Yeast Genetics” book (Amberg05) suggests growth the SOB + 300 mM NaCl
  • They also control pH at 7.5, which may be a major issue
  • Centrifuging in flat bottom centrifuge tubes may make pellet resuspension easier and less damaging
  • Length of time on ice prior to transformation may make a big difference
  • The Hanahan protocol specifies dry pure DMSO, while Inoue says it doesn’t make a difference. Let’s see.
  • Warm plates for growing cells after transformation are claimed to be 2x to 4x more efficient.
  • My lab uses LB for instead of SOB media…it seems to work fine for them–mel 18:10, 14 June 2007 (EDT)

References

  1. Inoue H, Nojima H, and Okayama H. High efficiency transformation of Escherichia coli with plasmids. Gene. 1990 Nov 30;96(1):23-8. DOI:10.1016/0378-1119(90)90336-p | PubMed ID:2265755 | HubMed [Inoue90]
  2. Hengen PN. Methods and reagents. preparing ultra-competent Escherichia coli. Trends Biochem Sci. 1996 Feb;21(2):75-6. PubMed ID:8851666 | HubMed [Hengen96]

All Medline abstracts: PubMed | HubMed

Transforming chemically competent cells (Inoue)-S2-PDF

zhourui
-
0

Method

  1. Thaw 25 – 200 μl TB buffer cells on ice. Do not use glass tubes, which adsorb DNA.
  2. Add DNA, pipette gently to mix (keep the volume of DNA less than 5% of the cell volume)
  3. Incubate on ice for 30 minutes
    • Note: If you are in a rush, you can shorten this incubation time to 5-10 min.
  4. Incubate cells for 30 seconds at 42°C.
  5. Incubate cells on ice for 2 min.
  6. Add 4 volumes of room temperature SOC (not critical)
  7. Incubate for 1 hour at 37°C on shaker.
    • Note: Can also save some time here by reducing incubation to ~45 min.
    • Note: Step can be eliminated if plating on Amp plates, but not most other antibiotics
  8. Spread 100-300 μl onto a plate made with appropriate antibiotic.
  9. Grow overnight at 37°C.

Experimental results

First attempt varied several parameters: incubation time on ice prior to heat shock, heat shock length, addition of DTT at 20mM.

  • DTT appeared to have little effect when added during transformation.
  • Incubating for 1/2 hour on ice had a positive effect, perhaps 1.5 to 2x efficiency gain.
  • Heat shock of 0 or 15 s rather than 30 s reduced efficiency about 8x
  • Heat shock at 30 s or 60 s gave approximately similar results. (*Edit: 50s is preferable)

Achieved efficiency was 3 x 107 per microgram. A control transformation with Invitrogen cells was at 1.2 x 108 per microgram.

 

One step ‘miniprep’ method for the isolation of plasmid DNA-S2-PDF

zhourui
-
0
One step ‘miniprep’ method for the isolation of plasmid DNA-S2-PDF

Overview

All ‘miniprep’ methods reported so far for the isolation of plasmid DNA involve multiple pipetting, extraction, centrifugation, and changes of miniature tubes. Screening large numbers of samples, they are therefore cumbersome, time-consuming, and not economical.

The technical report below by Chowdhury, K. (1991) is a very fast, simple, and one-step ‘miniprep’ procedure. The quality and quantity of DNA obtained by using this procedure are similar to those obtained by the other commonly used procedures of Serghini et al. (1) or Birboim and Doly (2). According to this procedure, the bacterial culture is directly extracted with a mixture of phenol-chloroform-isoamyl alcohol, and the liberated DNA is precipitated with isopropanol. This method is now being used routinely in our laboratory for isolating plasmids up to 12kb in size. A detailed description of the method is presented below:

Method

1. Take 0.5 ml of overnight E. coli culture in a microfuge tube. We routinely grow our cells in ‘standard 1’ bacteriological media supplied by Merck, Germany.

2. Add 0.5ml of phenol:chloroform: isoamyl alcohol (25:24:1). The phenol was saturated with TE (10mM Tris, 7.5, 1mM EDTA) before mixing with chloroform and isoamyl alcohol.

3. Mix by vortexing at the maximum speed for 1 minute. Alternatively, vortex for 10 seconds and then transfer to an Eppendorf mixer or an over-the-top rotator for 5 minutes.

4. Spin at 12,000g for 5 minutes. During the spin, prepare microfuge tubes with 0.5ml of isopropanol. After the spin, remove carefully about 0.45ml of the upper aqueous phase leaving the interphase undisturbed, and add it to the isopropanol. Mix well and spin immediately at 12,000 g for 5 minutes. The addition of salt and cooling is unnecessary.

5. Pour off the supernatant, add carefully 0.5ml of 70% ethanol to the side of the tube, and pour off. Repeat the washing once more. Vacuum dry the pellet and suspend in 100ul/ml RNAse). About 5-10ul of this DNA can now be cleaved with appropriate restriction enzyme(s) for analysis.

References

  • Chowdhury, K. (1991) One step ‘miniprep’ method for the isolation of plasmid DNA. Nucl. Acids Res 19:10 2792
  • Serghini, M.A. Ritzenthaler, C., and Pinck, J. (1989) Nucl. Acids Res 17, 3604
  • Birnboim, H.C., and Doly, J. (1979) Nucl. Acids Res. 13, 1513 – 1523.

Notes

  • Sterile LB broth works very well in this protocol
  • In step 1, one can pipette 1.5ml of broth spin the microfuge tube, decant 1ml, and leave behind 500ul to resuspend the pellet and continue as from step 2. This maximizes the total yield of the plasmid.
  • The largest band appearing after running a gel is usually genomic DNA. I run appropriate control markers.

 

Recombineering/Lambda red-mediated gene replacement-S2-PDF

zhourui
-
0
Recombineering/Lambda red-mediated gene replacement-S2-PDF

Overview

Single-gene knockouts using λ red system adapted from Datsenko and Wanner paper. The goal of this protocol was to create an endA (endonuclease I) knockout, but obviously it can be adapted to any gene. The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol. In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.

Since the λ red system can introduce unintended mutations, often people move the knockout to a fresh strain after it is verified. P1 transduction can be used to do this.

Materials

Not a complete list — see protocol for details, or update this list –smd 20:20, 5 March 2007 (EST)

  • plasmids
    • pKD46
      • pKD46 carries the λ red genes behind the araBAD promoter & is temperature sensitive (grow at <= 32 °C to maintain the plasmid). Use Ampicillin.
    • pKD3 (chloramphenicol) or pKD4 (kanamycin)
      • pKD3 = chloramhenicol resistance cassette. Require the pir gene product for replication, which means that a carry-over of the plasmids (and false positives) is not possible. The resistance cassettes is flanked by FRT sites, which allow the removal of the cassettes once inserted in the bacterial chromosome with a FLP helper plasmid.
        • pKD4 = kanamycin resistance version, if needed instead.
    • pCP20 (optional)
      • pCP20 contains a temperature-inducible flp gene for removing the chloramphenicol resistance gene you will introduce. Also confers ampicillin & chloramphenicol resistance.
  • reagents
    • L-arabinose
  • equipment
    • incubators (30°C and 37°C)
    • electroporator

Procedure

  • General outline
    • Grow up pKD46, pKD3, and pCP20 in host strains
      • pKD46 should be grown at <= 32oC to maintain the temperature sensitive plasmid.
    • Perform minipreps to extract plasmids
    • Transform pKD46 into target strain, plate out on LB-amp plates
    • PCR amplify linear fragment from pKD3 or pKD4 using oligos A and B (see below for design)
    • Make target strain (now maintaining pKD46) electrocompetent by growing at 30°C with L-arabinose
    • Electroprate linear DNA into electrocompetent cells
    • Grow at 37°C on chloramphenicol plates
    • PCR verify the deletion with oligos C and D (see below for design)
  • Detailed procedure
  • Day 0: Start overnight culture
    • Start overnight culture of strain containing gene to knock out.
  • Day 1: Preparation and transformation of competent cells
    • Make new glycerol stock of overnight strain (grown from single colony)
    • Add 300 μL overnight culture to 30 mL LB medium (1:100 dilution)
    • Check culture density every 30 minutes starting at +1 hour; grow to OD600 of 0.3 to 0.4
    • OD600 measurements of K91
      • +2:00 hrs: 0.06
      • +2:45 hrs: 0.3008
    • Spin at 2500rcf for 10 minutes at 4°C in two 50 mL centrifuge tubes (JA-20 rotor)
    • Decant supernatant, discard
    • Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix
      • Transformation Buffer
      • 10 mM Pipes
      • 15 mM CaCl2
      • 250 mM KCl
      • Titrate to pH 6.7 before adding MnCl2
      • 55 mM MnCl2
      • Filter sterilize
    • Incubate on ice for 10 min
    • Spin at 2500rcf for 10 minutes at 4°C
    • Decant supernatant, discard
    • Resuspend each pellet in 1.25 mL ice cold transformation buffer
    • Combine resuspended pellets in single tube
    • Remove 400 μL for immediate transformation
    • Add DMSO to a final concentration of 7% (160 μL). Drip the DMSO slowly into the cell suspension, with constant swirling by hand.
    • Incubate on ice for 10 min
    • Aliquot 400 μL each into five 1.5 mL tubes
    • Store in -80°C freezer.
    • Transform strain with pKD46 and grow on LB-amp plate at 30°C
      • Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
      • Add 100 μL of competent cell mix to each tube
      • Incubate on ice 30 min
      • Heat shock 30 seconds at 42°C
      • Incubate on ice 2 min
      • Spread all 100 μL on LB-amp-kan plate
      • Incubate at 30°C overnight
    • U45endA—pKD3[Cat]—D45endA fragment is chloramphenicol cassette with FRT sequences, flanked by 45 bp upstream and downstream of endA.
    • PCR U45endA— pKD3[Cat]—D45endA from pKD3 and verify on gel
      • PCR program: 95°C 7min → 35*[94°C 15s → 50°C 30s → 72°C 90s]
Contents Concentration Volume
pKD3 template 45 ng/μL 0.5 μL
forward primer 10 μM 5 μL
reverse primer 10 μM 5 μL
10x KOD buffer – 10 μL
dNTP 2 mM 10 μL
MgSO4 25 mM 4 μL
KOD polymerase 2 μL
dH2O – 64.5 μL
    • Make ten 10 μg/ml chloramphenicol plates and ten 25 μg/ml chloramphenicol plates
  • Day 2
    • Make 1 M stock of L-arabinose
      • MW of L-arabinose is 150.13
      • Add 1501.3 mg of L-arabinose to 8.5 g dH2O to make 1 M stock
    • Retrieve plates from incubator
    • Check results from the transformation
      • 1 ng pKD46 transformation yielded about 10 colonies
      • 10 ng pKD46 transformation yielded about 100 colonies
      • 100 ng pKD46 transformation yielded several hundred colonies
    • Pick some colonies and grow at 30°C in 2 mL LB + 50 μg/mL Amp
      • add 50 μL 10 mg/mL Ampicillin stock
    • Include enough samples for two conditions: +/- L-arabinose induction
    • When OD600 of cells(+pKD46) reaches 0.1, add L-arabinose to concentration of 10 mM to induce pKD46 λ-red expression
      • add 20 μL 1 M L-arabinose to 2 mL culture
    • Continue to grow at 30°C to OD600 = 0.4
    • Aliquot 1 mL each into two 1.5 mL centrifuge tubes
    • Chill cells in ice-water bath 10 minutes
    • Centrifuge 10 min at 4000rcf 4°C
    • Pipette off supernatant and resuspend pellets in 1 mL ice-cold dH2O
    • Centrifuge 10 min at 4000rcf 4°C
    • Resuspend pellet in 50 μL dH2O
    • For electroporation step, include 2 conditions: +/- PCR fragment
    • Chill electroporation cuvettes for 5 minutes on ice
    • Add 5 pg to 0.5 μg PCR amplified DNA to cells
    • Set electroporation apparatus to 2.5 kV, 25 μF. Set the pulse controller to 200 ohms
    • Place the cuvette into the sample chamber
    • Apply the pulse by pushing the button
    • Remove the cuvette. Immediately add 1 mL LB medium and transfer to a sterile culture tube
    • Incubate 60-120 min with moderate shaking at 37°C
    • Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 μg/mL, 25 μg/mL)

Notes

Designing necessary primers

  • First look at the sequence of the plasmid containing the resistance marker you wish to swap in for your target gene.
    • NCBI sequence viewer: pKD3
      • priming site 1: GTGTAGGCTGGAGCTGCTTC
      • priming site 2: GGACCATGGCTAATTCCCAT
      • priming site 2 reverse complement: ATGGGAATTAGCCATGGTCC

 

  • pKD3 Cat sequence (1034 bases)

GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCC TGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTC GCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGA GACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTC GTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGC CATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAAT ATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGT GATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCT TACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCAC AGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCAT

  • Next, find the sequence (and context sequence) of the gene you wish to remove
    • In this example, I found the sequence and context for endA (808 bases total)
      • MG1655_m56_ABE-0009661 +50bp upstream +50bp downstream

CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGATGTACCGTTATTTGTCTATTGCTGCGGTGGTACTGAGCGCAGCATTTTCCGGC CCGGCGTTGGCCGAAGGTATCAATAGTTTTTCTCAGGCGAAAGCCGCGGCGGTAAAAGTCCACGCTGACGCGCCCGGTACGTTTTATTGCGGATGTAAAATTAA CTGGCAGGGCAAAAAAGGCGTTGTTGATCTGCAATCGTGCGGCTATCAGGTGCGCAAAAATGAAAACCGCGCCAGCCGCGTAGAGTGGGAACATGTCGTTCCCG CCTGGCAGTTCGGTCACCAGCGCCAGTGCTGGCAGGACGGTGGACGTAAAAACTGCGCTAAAGATCCGGTCTATCGCAAGATGGAAAGCGATATGCATAACCTG CAGCCGTCAGTCGGTGAGGTGAATGGCGATCGCGGCAACTTTATGTACAGCCAGTGGAATGGCGGTGAAGGCCAGTACGGTCAATGCGCCATGAAGGTCGATTT CAAAGAAAAAGCTGCCGAACCACCAGCGCGTGCACGCGGTGCCATTGCGCGCACCTACTTCTATATGCGCGACCAATACAACCTGACACTCTCTCGCCAGCAAA CGCAGCTGTTCAACGCATGGAACAAGATGTATCCGGTTACCGACTGGGAGTGCGAGCGCGATGAACGCATCGCGAAGGTGCAGGGCAATCATAACCCGTATGTG CAACGCGCTTGCCAGGCGCGAAAGAGCTAACCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC

  • Construct primers that have internal overlap with the resistance marker (pKD3) and external overlap with the target knockout gene (endA).
    • Forward primer: A
      • CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTC
    • Reverse primer: B
      • GGTTGTACGCGTGGGGTAGGGGTTAACAAAAAGAATCCCGCTAGTGTAGGATGGGAATTAGCCATGGTCC
  • Construct primers that only flank the target gene (endA) for PCR verification
    • Forward primer: C
      • CCAAAACAGCTTTCGCTACGTTGCT (25 bases)
    • Reverse primer: D
      • GGTTGTACGCGTGGGGTAGGGGTTA (25 bases)
  • Figure out the sequence and size of what you should expect if everything works. In this case, it’s Cat inserted into endA flanking region (1132 bases total)

CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTC GGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGCATGGAAGCCATCACAAA CGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCC ACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACA CGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAAC AAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGA TAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAA ATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAA ATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTA TCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAG GAACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCATCCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC

References

Literature

  1. Datsenko KA and Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000 Jun 6;97(12):6640-5. DOI:10.1073/pnas.120163297 | PubMed ID:10829079 | HubMed [Datsenko-PNAS-2000]

λ red Links

endA Links

1...181920...27Page 19 of 27

One-stop bio-protocol library

Company

Trending

Categories

© protocolbio