Tuesday, December 24, 2024
Subscribe
Home Blog Page 24

Mesoplasma florum:restriction enzyme tests-PDF

zhourui
-
0
Mesoplasma florum:restriction enzyme tests-PDF

Material

Lysis buffer

  • 100 mM Tris-HCl pH 8.0
  • 50 mM NaCl
  • 5 mM EDTA
  • 0.1% Triton X-100

Reaction buffer

  • 20 mM Tris-HCl pH 7.5
  • 50 mM NaCl
  • 10 mM MgCl2
  • 1 mM DTT
  • This is essentially NEB Buffer 2, which has pH 7.9 and 10 mM Tris

Procedure

  • Put a colony or pelleted cells into 250 ul of lysis buffer
  • Incubate for 15 minutes at room temperature with shaking or vortexing
  • Centrifuge at high speed 1 min
  • Add 1-4 μL to 20 μL of reaction buffer with 500 ng of lambda DNA
  • Incubate 1-2 hours at 30°C
  • Run gel

Mesoplasma florum: Tn5 Transposase-PDF

zhourui
-
0
Mesoplasma florum: Tn5 Transposase-PDF

Overviw

Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.

Materials

  • pWH1891 plasmid (kind gift of Prof. Wolfgang Hillen)
  • BL21(DE3)pLysS cells
  • TEGX buffer
    • 10 mM Tris-HCl pH 7.5
    • 700 mM NaCl
    • 1 mM EDTA
    • 10% glycerol
    • 0.1% Triton X-100
  • Storage buffer (Epicentre)
    • 50% glycerol
    • 50 mM Tris-HCl pH 7.5
    • 100 mM NaCl
    • 0.1 mM EDTA — our version has 5 mM EDTA, since we never want in-vitro action
    • 1 mM DTT

Protocol

  • Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture overnight
    • Grow in 35 ug/ml chloramphenicol and 100 ug/ml carbenicillin
  • Centrifuge and remove the supernatent to eliminate beta-lactamase from the medium.
  • Inoculate 1 liter of LB/Cm/Amp culture medium with the culture and grow for 5-6 hours at 25 C until OD 0.5
  • Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 3-5 hours
  • Split and spin down cultures and resuspend in 80 ml cold water transferring to 50 ml centrifuge tubes
  • Spin down a second time and resuspend in 2 x 5 ml cold TEGX + Roche Complete protease inhibitor
  • Sonicate 3x pausing 10 minutes between sonications with the cells on ice
  • Centrifuge at 4C to remove cell debris – 1 hour at 16,000 x g
  • Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads)
  • Wash the column with 100 ml cold TEGX buffer
  • Load the cell supernatent onto the column and allow it to flow through
  • Flow the supernatent past the column a second time
  • Wash the column with 200 ml TEGX buffer
  • Add 1 ml of 1M DTT to 20 ml of TEGX buffer
  • Flow the 21 ml DTT + TEGX into the column
  • Cap the column and hold at 4°C overnight
  • Recover the protein with 10 ml TEGX buffer flowed through the column
  • Recover a second 10 ml similarly
  • Concentrate the protein by spinning in Centricon YM10
  • Dilute concentrate with 40% glycerol to bring final to 50%
  • Store aliquots at -80 and -20
  • Dilute to final 100 ng/ul (1.8 pmol/ul) with storage buffer for use

Molarity

  • Gel runs at 55 KD, approximately correct for a 450 AA protein.
  • Kostner06 uses 100-500 fmol DNA + 5x excess protein, or .5 – 2.5 pmol
  • 1 pmol protein = 55000 g/mol * 1e-12 mol = 55 ng
  • 1 pmol transposon = 2700 * 660 * 1e-12 = 1.8 ug
  • 100 fmol transposon = 180 ng

DNA binding tests

  • Use constant 200 ng of DNA (dilute from 1 ug/ul stock)
  • Use serial dilutions of protein starting at 8 ug/ul
    • 2x dilutions 0, 2, 1, 500, 250, 125, 62.5, 31.25, 15.6, 0 into 20ul TEGX + 200 ng/ul transposon DNA
  • Incubate 30 minutes at 37
  • Run on 0.8% E-Gel
  • DNA mixture 10*200 ng = 2 ug DNA = 2 ul DNA into 200 ul TEGX
  • Tests 3/24
    • 2 ul 116 ng/ul ME0 PCR DNA
    • 500 ng, 250, 125, 62.5, 31 ng Tpase in 20 ul final volume of storage buffer
    • incubate 1 hour 37C
    • overnight at 4C

Gel images, Goryshin00

  • Fig 1, 1.8 Kb transposon reacted at 2.5 ng/ul (total 1 ug) with Tn5 transposase at 10 ng/ul (total 4 ug) in 400 ul final volume, 1 hour at 37C
    • this is about 1 pmol of DNA and 72 pmol transposase, or a 72x molar excess of transposase
    • Concentrated to 20 ul and run on a 1.2% gel
  • 3.7 Kb transposon reacted at 50 ng/ul (2 ug total) with Tn5 transposase at 10 ng/ul (400 ng total) in 40 ul volume, 1 hour at 37C
    • this is 1 pmol DNA and 7.2 pmol transposase, for a 3x molar excess

Goryshin98 DNA binding and cutting tests

  • 0 to 3.8 pmol (nominal 2 ul of transposase, or 200 ng) of Tn5 transposase added to 0.26 pmol (nominal 1 ug of 5700 bp plasmid) plasmid in 20 ul volume
    • done with a buffer of 100 mM potassium glutamate, 25 mM Tris-acetate pH 7.5, 10 mM Mg-acetate, 50 ug/ml BSA, 0.5 mM b-mercaptoethanol, 2 mM spermidine, 10 ug/ml tRNA
    • incubated 1 hour at 20C, diluted 2-3x and incubated a further 4 hours at 37C (nominally to dilute CHAPS in transposase storage buffer)
    • results: near linear increase of cut out fragments with transposase molar excess of 0-9x

Standard Epicentre reaction

  • 1 ul DNA (100 ng/ul) in TE
  • 2 ul transposase
  • 1 ul glycerol
  • This is:
    • about 100 fmol or less transposon DNA
    • at 100 ng/ul, this is 3.8 pmol transposase or 38x molar excess
    • 25 ng/ul final, so expect 1e4 or so transformants

To Do

  • Prep new Tn5 protein (on hold, unnecessary)
  • quantitate existing stock with BSA dilution and gel (done, spec readings approximately correct)
  • Make storage buffer, dilute existing stock into storage buffer (done)
  • run Goryshin00 style test of transposome formation (to do; initial gel unconvincing)
  • Run Goryshin98 style test of transposon cutting (to do)
  • Try transforming E. coli cells (done, this is what counts, compared to Epicentre enzyme is OK)

pWH1891 Sequence information

  • T7 and Intein-R primers, ATG start at 45
  • Truncates aa’s 1-4 from canonical sequence
  • Mutations
    • E54K — improve binding to OE
    • M56A — eliminate start for C-terminal inhibitory protein
    • L372P — hyperactive mutation

>pWH1891
CCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTC GGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGT AGTAAAGCCGCCCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGG CTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGA TAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGAT GACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGG TCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGA GTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAA CGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGG AGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTA TACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATG GTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCCGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGG AACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGC AGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGT TGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCGGGTGCTTTGCCAAGGGTACCAATGTTT
TAATGGCGGATGGGTCTATGA

Testing the transposase

  • Transform 50 μl of E. coli Top10 electrocompetent cells with:
    • Tn5 transposons (1 μl); plate out on Tet plates, count colonies
    • pUC19 positive control 10 pg/μl; plate out on amp plates
    • Electroporation at 2.5 KV in 2 mm gap cuvette
    • pUC19 colonies visible in six hours under the microscope
    • Tet resistant colonies are not visible at that time

Notes

  • Davies00 uses 100 mM hydroxylamine as a cleavage reagent instead of DTT

Mesoplasma florum:RNA Purification-PDF

zhourui
-
0
Mesoplasma florum:RNA Purification-PDF

Cell Lysis

  • Start with 1 to 2 ml liquid culture.
  • Add 2 volumes RNAprotect Bacteria Reagent. Mix immediately by vortexing for 5 seconds.
  • Incubate at room temperature for 5 minutes.
  • Centrifuge for 10 minutes at 5000g.
    • There may not be a visible pellet after centrifugation, which is not a problem.
  • Pour out the supernatant and remove any residual liquid by gently dabbing the inverted tube once onto a paper towel.
  • Add 10 ul Proteinase K and 200 ul TE to the pellet. Carefully resuspend by pipetting up and down. Vortex for 10 seconds to mix.
  • Incubate at room temperature for 10 minutes. Use either a shaker-incubator or vortex for 10 seconds at least every two minutes.
  • Add 700 ul Buffer RLT and vortex. If particulate material is visible, pellet it and use only the supernatant
  • Add 500 ul Ethanol (96-100%) and mix by pipetting.

RNA Purification

  • Transfer 700 ul lysate to a spin column placed in a 2 ml collection tube. Close the lid gently and centrifuge for 15 seconds at ≥8000g (≥10,000 rpm). Discard the flow-through (do not mix FT with bleach). Repeat until all the lysate has been centrifuged through the column.
  • Add 350 ul Buffer RW1 to the column and centrifuge for 15 seconds at ≥8000g (≥10,000 rpm) to wash the spin column membrane. Discard the flow-through (do not mix the FT with bleach).
  • Add 10 ul DNase I stock solution to 70ul Buffer RDD. Mix by gently inverting the tube and centrifuge briefly to collect residual liquid from the sides of the tube. DO NOT vortex, it will denature DNase I.
  • Add the DNase I mix directly to the column membrane and incubate at room temperature for 15 minutes.
  • Add 350 ul Buffer RW1 To the column, wait for 5 minutes, and then centrifuge for 15 seconds at ≥8000g (≥10,000 rpm). Discard the flow-through.
  • Place the column in a new 2 ml collection tube. Add 500 ul Buffer RPE to the column, close the lid gently, and centrifuge for 15 seconds at ≥8000g (≥10,000 rpm) to wash the spin column membrane. Discard the flow-through.
  • Add 500 ul Buffer RPE to the column, close the lid, and centrifuge for 2 minutes at ≥8000g (≥10,000 rpm).
  • Place the column in a new 1.5 ml collection tube. Add 30-50 ul of RNase-free water directly to the column membrane. Close the lid and centrifuge for 1 minute at ≥8000g (≥10,000 rpm) to elute the RNA.
  • If the expected yield is >30 ug, repeat the previous step using another 30-50 ul of RNase-free water, or the water that was already used to elute.

Preparing DNase I (From Qiagen Cat. No. 79254)

  • Dissolve the solid DNase I in 550 ul RNase-free water. Inject the water into the vial using a needle and syringe.
  • Mix gently by inverting the vial. DO NOT vortex.
  • For long-term storage, remove the solution from the vial, divide it into single-use aliquots, and store it at -20°C for up to 9 months. Thawed aliquots can be stored at 4°C for up to 6 weeks. Do not refreeze aliquots once thawed.

Notes

7/1/08 TK:

  • Started with 600 ul in 2 ml tube, add 1200 ul RNA Protect
  • Vortex and incubate 10 minutes at RT
  • Spin down 5 min at 17000g
  • Decant supernatant, blot tube mouth dry
  • Add 200 ul TE
  • Add 10 ul proteinase-K, vortex
  • incubate for 10 min at RT
    • solution cloudy
  • Add 700 ul RLT
  • Add 500 ul EtOH
    • Some genomic DNA visible in solution, solution clears
  • Spin twice through a column with 700 ul each
  • Add 700 ul RW1, sit for 5 minutes, spin through
  • Switch the column to a new tube
  • Wash 3x with 500 ul RPE
  • Spin dry 1 min at 17000g
  • Transfer to a 1.5 ml tube
  • Elute 2x with 40 ul RNAse-free water
  • Run 1 ul and 3 ul on an E-Gel
  • Measure on nanodrop: 223 ng/ul in 70 ul, ratio 2.1
  • Gel shows clear 16S and 23S bands

Mouse keratinocyte cultures-PDF

zhourui
-
0
Mouse keratinocyte cultures-PDF

PRIMARY MOUSE KERATINOCYTE CULTURES

Isolation of epidermal keratinocytes from neonatal mice is based on the protocol of Dlugosz et al., Methods Enzymol. 254:3-20 (1995). The epidermis from a newborn mouse should yield approximately 5-10×106 cells, with a 30-40% plating efficiency.

  1. Sacrifice newborn mice by CO2 narcosis. Note: Newborn mice may require 10-15 min in the CO2 chamber.
  2. Sterilizing washes are performed in batch in a large beaker on ice, so that carcasses are completely submerged:
    1. Wash in 10% iodine solution in PBS for 10 min; decant.
    2. Rinse with sterile PBS (+pen/strep), then 70% ethanol, then wash in 70% ethanol for 10 min; decant.
    3. Rinse with sterile PBS, then keep mice in PBS (+pen/strep) on ice.
  3. Removal of skin is performed in a sterile environment.
    1. Remove the tail and prepare it for genotyping by PCR (see separate protocol).
    2. Remove limbs. (Optional: limbs can be used to prepare frozen skin sections).
    3. To remove skin from the torso and head, place the carcass on a sterile tissue culture dish. Use a sterile scalpel to make a longitudinal incision from tail to snout, then peel the skin from the carcass using sterile, curved forceps. Avoid puncturing the gut to maintain sterility. Layer the skin onto the bottom of a clean dish, with the dermis facing down, and spread out all edges. Allow the skin to dry for a short time (this can be done on ice).
  4. Use curved forceps to carefully pick up and place each skin, dermis facing down, onto 5 ml of cold, sterile 0.25% trypsin solution (GibcoBRL) in a 60mm tissue culture dish. Use the tips of the forceps to tease out edges that fold under, so that the skin is floating flat with most of the epidermis above the surface of the trypsin solution. Incubate at 4°C for 15 to 24 hrs.
  5. Transfer each skin to a dry, sterile tissue culture plate and spread it out with the epidermis facing down. Pull the dermis from the epidermis using a sterile pasteur pipette and discarded it (the dermis is a jelly-like blob; the epidermis is a thin, tissue paper-like sheet).
  6. Mince the epidermis and suspend it in 6 ml of growth medium using a 10 ml pipette. Transfer the suspension to a sterile 10 ml Falcon tube, and pump up and down to release keratinocytes from the epidermis. Pass the suspension through a sterile, 70μm nylon filter (Becton Dickinson) into a fresh 50 ml Falcon tube to remove cornified sheets. Rinse the initial tube with 5 ml fresh growth medium, and rinse it through the same filter into the same 50 ml tube (cells are in a final volume of 10-11 ml).
  7. Plate the entire 10 ml of keratinocyte suspension from each skin onto a 10cm tissue culture dish coated with ~30μg/ml denatured rat tail collagen (Vitrogen; Collagen Corporation).
    To prepare collagen-coated dishes:

    Dilute Vitrogen stock (~3 mg/ml) 1:100 in sterile PBS, then completely cover the surface of a 10cm dish with 3-5 ml. Incubate at 33°C for several hrs or at 4°C overnight. Completely aspirate collagen from the dish before adding cells. Note: Do not allow Vitrogen stock to warm, or it will begin to gel.

  8. Culture mouse keratinocytes at 33-34°C, 8% CO2 for five to seven days before use in experiments. If necessary for some experiments, the cultures can be passaged once or twice for expansion.

Growth Medium for Primary Keratinocytes

(see separate protocols for preparation of individual stock solutions)

EMEM, Ca++-free (BioWhittaker catalog #06-174G), supplemented with:

  • 4% FBS, chelated
  • 0.05 mM CaCl2
  • 0.4 μg/ml hydrocortisone
  • 5 μg/ml insulin
  • 10 ng/ml epidermal growth factor (EGF)
  • 10-10 M cholera toxin
  • 2×10-9 M T3
  • 100 units/ml penicillin and 100μg/ml streptomycin
  • 2 mM L-glutamine

STOCK PREPARATIONS:

FBS, chelex-treated

FBS is chelex-treated in batch with Chelex-100 resin (BioRad, cat # 1422832) to remove free Ca++. Use 100 g chelex resin per 500 ml FBS. Swell 100 g chelex resin in 400-500 ml distilled water, then titrate to pH 7.4 with HCl while stirring (pH will take a while to stabilize during titration). Filter through Whatman #1 paper. Scrape resin slurry into 500 ml FBS and stir at room temp for 3 hr or at 4°C overnight. Filter the chelated FBS through Whatman #1 paper and discard the resin slurry. Filter the chelated FBS through a 0.2μm bottle filter to sterilize it. Aliquot sterile, chelated FBS at 20 ml/tube and store at 20°C.

Add 20 ml chelated FBS per 500 ml bottle of EMEM (final conc’n = 4%).

CaCl2

Prepare a stock of 0.1 M CaCl2 in sterile water. Filter sterilize with 0.2μm filter.

Add 250μl of 0.1 M CaCl2 per 500 ml bottle of EMEM (final conc’n = 0.05mM).

Hydrocortisone

Sigma, cat # H0888 Prepare a concentrated stock of 5 mg/ml by dissolving 50 mg hydrocortisone in 10 ml 95% EtOH. Store the concentrated stock at 20°C.

Prepare a 0.2 mg/ml stock by adding 0.4 ml of concentrated stock to 9.6 ml of sterile, serum-free EMEM. Aliquot at 1.0 ml/tube; store at 20°C.

Add 1.0 ml of 0.2 mg/ml hydrocortisone per 500 ml bottle of EMEM (final conc’n = 0.4μg/ml).

Insulin

Bovine Insulin; Sigma, cat # I6634 Prepare a 5 mg/ml stock: Dissolve 100 mg insulin in 20 ml of 0.005 N HCl (prepared by adding 10μl concentrated HCl to 20 ml water).

Filter sterilize with 0.2μm filter and aliquot at 0.5 ml/tube; store at 20°C.

Add 0.5 ml of 5 mg/ml insulin per 500 ml bottle of EMEM (final conc’n = 5μg/ml).

Epidermal Growth Factor (EGF)

Recombinant human EGF; GibcoBRL, cat # 13247-051

Prepare a 10μg/ml stock: Dissolve 100μg EGF in 1 ml 0.1% BSA (10 mg ultrapure BSA in 10 ml water). Bring volume to 10 ml with 0.1% BSA. Filter sterilize with 0.2μm filter and aliquot at 0.5 ml/tube; store at 20°C.

Add 0.5 ml of 10μg/ml EGF per 500 ml bottle of EMEM (final conc’n = 10 ng/ml).

Cholera Toxin

ICN, cat # 190329 Prepare a concentrated stock of 10-5M by dissolving 1 mg (1 vial) cholera toxin in 1.18 ml distilled water. Store the stock at 4°C (do not freeze the concentrated stock).

Prepare a 10-7M stock by adding 0.1 ml of the concentrated stock to 10 ml EMEM + 4% FBS. Filter sterilize with 0.2μm filter and aliquot at 0.5 ml/tube; store at 20°C.

Add 0.5 ml of 10-7M cholera toxin per 500 ml bottle of EMEM (final conc’n = 10-10 M).

T3 (3,3’,5-triiodo-L-thyronine)

Sigma, cat # T6397

Prepare a concentrated stock of 2×10-4M by dissolving 13.6 mg T3 in 15 ml 0.02N NaOH, then bringing the volume to 100 ml with PBS. Distribute in 10 ml aliquots and store at 20°C.

Prepare a 2×10-6M stock by adding 0.1 ml of the concentrated stock to 10 ml PBS. Filter sterilize with 0.2μm filter and aliquot at 0.5 ml/tube; store at 20°C.

Add 0.5 ml of 2×10-6M T3 per 500 ml bottle of EMEM (final conc’n = 2×10-9 M).

Transform by Electroporation-PDF

zhourui
-
0

Materials

  • 50mL 7H9 mycobacterial medium + 3mL per transformation
  • 102mL 10% glycerol (possibly a few mL more if you are doing many transformations)
  • 400mL PBS + 0.1% Tween 80 per transformation
  • electroporation cuvettes and electroporator
  • LB agar plates carrying the relevant antibiotic markers
  • frozen aliquot of M. smegmatis

Directions

  1. Thaw the aliquot of M. smegmatis and inoculate 50mL 7H9 with 100-200μL of it (depending on the concentration of stock). Incubate shaking at 37°C until the optical density at 600nm is between 0.6 and 0.8. This is the range where you get the highest transformation efficiency.
  2. Divide the culture into two 25mL screw cap tubes. Pellet the cells at 3,000rpm for 10 minutes and resuspend each in 25mL glycerol. Repeat twice more, the last time resuspending each in 1mL glycerol. This ensures that the medium is fairly pure. If it’s not, then the medium will arc when you electroporate.
  3. Prepare the recovery tubes: one test tube of 3mL 7H9 per transformation. Put 300μL of cells in 10% glycerol in each electroporation cuvette, and add the DNA (on the order of 3ng per transformation).
  4. Electroporate at 2.5kV, 1kΩ, and 25μF. Should yield time constants of 15 to 25ms. Immediately transfer the cells to their recovery tube. When all the transformations are done, incubate the recovery tubes shaking at 37°C for at least 3 hours.
  5. Pellet the tubes at 3,000 rpm for 10 minutes, and resuspend in 400μL PBS + 0.1% Tween 80. Plate each tube on two LB agar plates with the relevant antibiotics, 200μL per plate. Incubate the plates at 37°C.

Notes

Unlike E. coli, there is no need to keep mycobacteria cold when transforming them. Indeed, there is some evidence that M. tuberculosis may transform better at room temperature.

Isolation of murine splenocytes-PDF

zhourui
-
0
Isolation of murine splenocytes-PDF

Overview

In order to study spleen cells (e.g. lymphocytes, granulocytes, other immune cells), it helps to make single-cell suspensions so that the cells can be manipulated ex vivo easily. This protocol suggests ways in which you can do this without a lot of equipment or expensive supplies. This protocol can also be used to make cell suspensions from other lymphoid organs, such as the thymus or lymph nodes (see Current Protocols in Immunology, Unit 1.9 ).

Materials

All materials listed are for use with one mouse.

Supplies

  • 15ml conical tube
  • 60mm petri dish
  • 5ml pipet
  • 100μm cell strainer (can substitute autoclaved fine nylon mesh for Protocol B)
  • 3mL sterile disposable syringe, no needle attached (Protocol A only)
  • frosted-end glass slides (x 2) (Protocol B only)
  • 50ml conical tube (Protocol B only)

Reagents

  • DMEM-10 (about 20mL)
    • 1L DMEM (with 4.5g/L glucose, L-glutamine, sodium pyruvate; from Mediatech, catalog# 10-013-CM)
    • 100mL fetal bovine/calf serum
    • 10mL 100X PSG (penicillin G sodium, streptomycin sulfate, L-glutamine; from Gibco, catalog# 10378-016)
      • sterilize using 0.2μm filter; store at 4°
  • ACK lysis buffer (1mL)
    • 1L deionized water
    • 8.29g NH4Cl
    • 1g KHCO3
    • 37.2mg Na2-EDTA
      • pH solution to 7.2-7.4; sterilize using 0.2μm filter; store at 4°
  • 70% ethanol
  • trypan blue solution

Equipment

  • scissors
  • forceps
  • small plastic or glass beaker
  • dissection stage (can be styrofoam shipping box lid wrapped in aluminum foil)
  • P1000 pipette
  • hemacytometer
  • phase microscope
  • centrifuge

Procedure

Protocol A

Set-Up

  1. Clean dissection stage with 70% ethanol.
  2. Add ethanol to the beaker and place ends of scissors and forceps into the beaker to sterilize.
  3. Add 8-10mL of DMEM-10 to the petri dish.
  4. Place the cell strainer into the dish with the DMEM-10.

Procedure

  1. Wet fur on left side of sacrificed mouse using 70% ethanol.
  2. Cut out the spleen.
    1. Cut away the fur along the left side of the mouse, about half-way between the front and back legs.
    2. Cut open the body cavity.
    3. Remove the spleen using the forceps (the spleen is the color of a kidney bean; it is longer and flatter than the kidney).
  3. Place the spleen into the cell strainer. Using the plunger end of the syringe, mash the spleen through the cell strainer into the petri dish.
  4. Rinse the cell strainer with 5mL DMEM-10. Discard the strainer.
  5. Transfer the suspended cells to a 15mL conical.
  6. Spin cells at 800xg for 3 minutes.
  7. Discard supernatant and resuspend pellet in 1mL ACK lysis buffer. Incubate at RT for 5-10 minutes. Add 9mL DMEM-10 and spin as before.
  8. Discard supernatant and resuspend pellet in 3mL DMEM-10, discarding any dead cell mass.
  9. Count cells (dilute 10μL cell suspension in trypan blue, and count with hemcytometer).

Protocol B

Set-Up

  • same as Procedure B, except replace step 4 with:
  1. Sterilize the frosted end of the glass slides by dipping in or spraying with ethanol. Take care to only touch the non-frosted ends with your gloves.

Procedure

  • same as Procedure B, except replace steps 3 with:
  1. Place the spleen directly into the DMEM in the petri dish.
  2. Homogenize the spleen between the frosted ends of the slides.
  3. Pass the homogenized spleen through the cell strainer (or nylon mesh) mounted on a 50mL conical.
  4. Continue with step 4 of Procedure A.

Notes

  • Keep cells on ice or at 4° if you do not plan to use them right away.
  • If sterility is desired, perform all steps in a laminar flow culture hood.

References

  1. Current Protocols in Immunology, Unit 1.9: Removal of Lymphoid Organs link (subscription required)
  2. Current Protocols in Immunology, Unit 3.1: Isolation of Mouse Mononuclear Cells link (subscription required)

Tamoxifen administration to mice-PDF

zhourui
-
0
Tamoxifen administration to mice-PDF

Tamoxifen administration via Chow

  • pro: less labor-intensive and less stressful for the animals
  • con: dosage depends on eating behavior; induction may take longer than IP
  • tamoxifen formulation in typical mouse food pellets have just become commercially available (Harlan Teklad CRD TAM400/CreER)
  • 400 mg tamoxifen citrate per kg food irradiated pellets
  • dosage is based on Kiermeyer et al. 2007 “Optimization of spatiotemporal gene inactivation in mouse heart by oral application of tamoxifen citrate.” (PMID 17216603) where efficient induction took 4 weeks. It appears that the speed of induction is highly dependent on target genes (LoxP insertion sites) and can be as short as days.

Tamoxifen administration via drinking water

  • pro: less labor-intensive and less stressful for the animals
  • con: dosage limited by the low solubility of tamoxifen in water; dosage depends on drinking behavior; induction may take longer than IP
  1. dissolve 100mg tamoxifen in 100µl pure ethanol (10mg/100µl = 100mg/ml tamoxifen)
  2. dilute 100-200x in distilled water to a final concentration of 1-0.5mg/ml
  3. use 1% ethanol in distilled water as a negative control
  4. replace water in drinking bottles with tamoxifen solution; let mice drink at will

compare Gail et al 1999, PMID 10547390, p355: treatment of mice

Tamoxifen administration using a feeding needle

  • pro: dosage more precise than feeding and drinking (less than IP)
  • con: time consuming; stressful for animals

final concentration: 100µg/µl ~ 1mg/10µl

  1. 100 mg Tamoxifen-free base (Sigma, T5648) was suspended in 100 μl Ethanol and solved in 900 μl peanut oil (Sigma). This 10 mg/100 μl tamoxifen solution was shaken rigorously at 55°C (Tamoxifen precipitates at RT) and divided into aliquots of 50 μl (1 daily dose = 5mg). Store at -20°C.
  2. heat to 37°C before administration. Verify that tamoxifen is properly dissolved.
  3. feed orally to mice with a feeding needle. Fix the mice at their neck and ridge so that the belly is directed to the floor. Hold the mouse tightly so that it can not move the head, but not too tight to avoid choking. Carefully introduce the feeding needle in the mouth behind the tongue (max. 1 cm). It is helpful to mark 1 cm on the needle with an edding pen to see how deep you have inserted the needle.
  4. slowly introduce 50 μl of the tamoxifen solution with the syringe; ensure swallowing;
  5. e.g. repeat this procedure for 5 days once a day (efficiency of induction depends on Cre and transgene; determine your dosage)

Tamoxifen administration by intraperitoneal injection

  • pro: reliable dosage
  • con: probably the most stressful method for the mouse; requires proficient handler

Intracellular cytokine staining for flow cytometry (mouse)-PDF

zhourui
-
0
Intracellular cytokine staining for flow cytometry (mouse)-PDF

Overview

Staining for intracellular cytokines, followed by flow cytometry analysis, can provide single-cell information about a cell population that one cannot obtain from surface staining or ELISA (enzyme-linked immunosorbent assay).

Materials

Supplies

  • 96-well V-bottom plate
  • 12 x 75mm Falcon round-bottom tubes

Reagents

  • DMEM-10
    • 1L DMEM (with 4.5g/L glucose, L-glutamine, sodium pyruvate; from Mediatech, catalog# 10-013-CM)
    • 100mL fetal bovine/calf serum
    • 10mL 100x PSG (penicillin G sodium, streptomycin sulfate, L-glutamine; from Gibco, catalog# 10378-016)
    • 10mL HEPES buffer solution (1M)
    • 10mL non-essential amino acids solution (10mM, 100X; Gibco catalog# 11140)
    • 1mL 2-mercaptoethanol (1000X)
      • sterilize using 0.2μm filter; store at 4°
  • stimulation solution
    • 5mL complete DMEM
    • 2.5μL of 200µg/ml PMA (phorbol 12-myristate-13-acetate)
    • 1.35μL of 10mM ionomycin
    • 20μL of 10mg/ml brefeldin A
      • chemicals will stick to plastic; make just before use, and discard solution afterwards
  • FACS buffer
    • 97mL PBS (phosphate buffered solution)
    • 3% fetal bovine/calf serum (i.e. 3mL)
    • 0.1% sodium azide (i.e. 100μL; optional, especially if you do not plan to store the buffer after use)
  • PBS (phosphate buffer solution)
  • BD Cytofix/Cytoperm solution (or 4X eBioscience permeabilization solution and eBioscience permeabilization diluent)
  • BD Perm/Wash buffer (or 10X eBioscience permeabilization buffer)
  • antibodies
    • Fc block (2.4G2)
    • fluorochrome-linked surface markers (e.g. CD3e, CD4, CD8)
    • fluorochrome-linked cytokine antibodies (e.g. IFN-gamma, IL-12)

Equipment

  • P200 pipette
  • P200 or P300 multichannel pipette (optional)
  • flow cytometer

Procedure

  1. Dilute single-cell suspensions to 10×10^6 cells/mL in complete DMEM.
  2. Add 100µl cells per well (do not forget to make wells for your staining controls).
  3. Add 100µl stimulation mix (final concentrations: PMA = 50 ng/ml, ionomycin = 1µg/ml, brefeldin A = 10µg/ml)
  4. Incubate 37° for 4 hours.
  5. Spin plate at 800 x g, 3 minutes, at 4°.
  6. Wash 3 times with cold PBS, spinning as in step 5.
  7. Resuspend in 100µl Fc block (recommended dilution: 1:1000 in FACS buffer). Incubate on ice, 10 minutes. Spin.
  8. Resuspend in 100µl surface antibody mixture (recommend dilution: 1:200 in FACS buffer). Incubate on ice, 20 minutes in the dark. Spin.
  9. Wash once with cold PBS.
    • Note: for steps 10 through 13, either use all of BD reagents or all of eBioscience reagents. Do not mix-and-match.
  10. Resuspend in 200µl of either BD Cytofix/CytoPerm solution OR 1X eBioscience permeabilization solution. Incubate on ice, 30 minutes in the dark. Spin 1500 x g, 5 minutes, 4°.
  11. Wash once with 200µl either BD Perm/Wash buffer OR 1X eBioscience permeabilization buffer. Spin as in step 10.
  12. Resuspend in 100µl cytokine stain (recommended dilution: 1:100 in 1X Perm/Wash OR permeabilisation buffer). Incubate on ice, 30 minutes in the dark. Spin as in step 10.
  13. Wash twice with BD Perm/Wash OR eBioscience permeabilization buffer, spinning as in step 10.
  14. Resuspend cells in 100-200µl FACS buffer and transfer to Falcon round-bottom tubes for acquisition on a flow cytometer.

Notes

  • If you make the FACS buffer fresh every time, there is no need to add sodium azide to the buffer.
  • All antibody concentrations here are only recommendations. You should titrate the antibody concentrations for your specific cell populations.
  • Non-commercial reagents can also be used for this protocol. See Current Protocols, Unit 6.24 [1].
  • As you are permeabilizing the cells through this protocol, the cells are not viable. You cannot sort your cells based on intracellular staining.

Mouse tissue lysis for genotyping-PDF

zhourui
-
0
Mouse tissue lysis for genotyping-PDF

Material

  • proteinase K
  • Taq 10x buffer
  • tabletop shaker/incubator

Procedure

tissue lysis to release DNA

per tail or tissue chunk add (tissue degradation is sped up if tissue/tail is cut into smaller bits):

  • 100 µl Taq DNA polymerase 10x Reaction buffer with MgCl2 (e.g. Promega #M1883) diluted 1:10 in ddH2O
  • +2 µl proteinase K (20 mg/ml)
  • incubate for 3h to o/n at 50°C at 300 rpm
(proteinase K is stable over a broad pH range (4.0 to 12.5, optimum pH 8.0) and is also stable over the temperature range of 25 to 65°C)

proteinase K inactivation

  • 95°C for 10-20 min at 300 rpm
  • centrifuge at 13000 rpm for 3 min and transfer supernatant (80 µl) into new eppi

storage before PCR

  • 4°C short term, -20°C long term

DNA extraction from tissue-PDF

zhourui
-
0
DNA extraction from tissue-PDF

Proteinase K digestion

  1. Mix DNA extraction buffer
    • 98 μl ReagentB
    • 2 μl ProteinaseK
    • Mix fresh. 100 μl is enough for a small pea size chunk of tissue or one embryo
  2. Place a small piece of tissue or embryo into a microfuge tube containing 100 μl of extraction buffer
  3. Incubate at 50°C overnight

Phenol/chloroform/isoamyl (PCI)

  1. Prepare PCI mix
    1. One part tris-saturated phenol to one part 24:1 Chloroform: Isoamyl alcohol
    2. Shake thoroughly to make emulsion
  2. Add one volume of PCI to the extracted sample
  3. Shake tubes for 10 seconds
  4. Centrifuge at max speed for 5 minutes
  5. Remove the aqueous phase to a new tube
  6. Repeat as needed
  7. Add one volume of 24:1 chloroform: isoamyl alcohol
  8. Shake tubes for 10 seconds
  9. Centrifuge at max speed for 5 minutes
  10. Remove the aqueous phase to a new tube
  11. Continue to precipitation

Ethanol precipitation

  1. Add 2 volumes 100% EtOH
  2. Add 1/10 volume 3M Sodium Acetate pH 5.0
  3. Centrifuge at max speed for 10 minutes
  4. Decant ethanol
  5. Add 150 μl 70% EtOH
  6. Centrifuge at max speed for 2 minutes
  7. Pipette out ethanol
  8. Airdry pellet
  9. Resuspend pellet in MilliQ water
1...232425...27Page 24 of 27

One-stop bio-protocol library

Company

Trending

Categories

© protocolbio