Friday, April 18, 2025
Subscribe
Home Blog Page 9

Cloning in silico-PDF

zhourui
-
0

ESTs based

databases of pre-clustered ESTs

A shortcut to obtain either consensus sequence (TIGR) or a set of ESTs (Unigene) derived from a gene of interest.

  • STACKdb (limited access, tissue-specific splice forms) [1]
  • Unigene (no consensus sequence) [2]
  • TIGR [3]

Search of EST databases using BLAST

  1. Depending on the level of homology we can use:
  • blastn program, cDNA sequence as query, EST DB from the same species (== novel splice forms discovery in the same species)
  • tblastn program, protein sequence as a query, EST DB from the same (==paralogue discovery) or other species (== cloning any homologs)

If possible, use protein sequences from related species i.e. zebrafish protein when looking for a homolog in salmon), but for a large number of proteins one can detect homology between humans and C.elegans.

  1. Restrict blast output with species, i.e search only porcine ESTs to simplify the output
  2. On the BLAST output page select reasonable hits by checking a box on the left in the alignment section.
  3. Retrieve all checked results as FASTA file (i.e. pig_Xgene_ESTs_date_round1.fasta
  4. check how many sensible hits you got, i.e. using grep on Unix/Linux
grep '>' pig_Xgene_ESTs_date_round1.fasta | wc
  1. assembly all your EST sequences using phrap (on Unix command line):
phrase pig_Xgene_ESTs_date_round1.fasta

you should get file: pig_Xgene_ESTs_date_round1.fasta.contigs

If you do not have phrap you may use:

  • CAP3
  • ESSEM (Est’s aSSEmbly using Malig) from the Technical University of Catalonia.

You may download sequences of human SYNGR4 [ESTs http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?UGID=221005&TAXID=9606&SEARCH= here], save it as FASTA file and then feed CAP3 or ESSEM with it to check how it works. Use Suggested assembly sequence:

>assembly: gnl|UG|Hs# -> gnl|UG|Hs# (R)
TTTTTTTTTTTTTTTGTTTTTAGAAACCCTTCTGGAGGGAGGATTCTCTCTTTATTGATTTGGATAAGGATATTTAGTTG
TCAGGCATCATAGCAAGCCGGGGGGACTTTGGAGCGGTCAGACAGGGGGACAGGGCAGAGCTAGCATAACTCAGGCTGTT
GGGGCCAGTGGTGGGCATGTTCACAGGGCTGTTGGCAGAGGGCAAGGGGAGGGTGGTCAGCACCATGCCACCCTCATCCA
GGAAGCGCTTGTAAGGGACTGGAGCATCATTTCGGAGGTCCTGGAATGCCAGGTAGGCCTGGAATATCCAGACAAGGATG
GAGAAGAAGGTGAAGGCGATGGCTGCCTGGCACTGCTGCTCCCCAGGAGGAACTCTTTGGGCGGCGAATGCTGCCATTGG
TTGGCCAGGAAGCAGAAACCCATGAACCAGACAACTGCCCAGAGAACAGCCAGGATGAAGTCCAGGAGCTGGAAGGCTGT
CTTGAAGCGGGTGCCGGCAATGCGGGTCTCCTGTGTGTCCAGGACGAGGAAGGCCAGCCACGCTGAGGAAGGCCAGGAAG
CCGGCTCCCACGGCAAAGCTGCAGGCCACGCTGTTGCTGTTGAGAATGCAGTGGAGCTGCGGAGACTCCATCTTGTTCTG
GTAGCCGTCGGTCAGCAGGGAGGAGAAGACGATCAGGGAGAAGACCCCTGCCTCCCCCACACTCTCCTTCTGCCACCAAA
CC
  1. mask possible repeats using the RepeatMasker server. EST libraries are notorious for containing non-spliced ESTs/contaminations.
  1. use masked consensus sequence (MCS) from the step above in the next round of BLAST search:

in the blastn program, MCS as query, EST DB from the same species

check how many sensible hits you got.

  1. repeat EST assembly, repeat masking, and compare new EST contigs with contigs from the previous step until you get no new hits in the EST database.
  2. after every assembly step make sure that the contig you use contains a sequence of interest (== compare it with the first cDNA or protein sequence)

Genome annotation using ESTs assembly

  • PASA http://www.tigr.org/tdb/e2k1/ath1/pasa_annot_updates/pasa_annot_updates.shtml

Importing human, mouse, and zebrafish EST trace files

For a significant subset of human, mouse, and zebrafish ESTs there are available trace and even experiment files. For sane gene cloning, we need them because:

  • sequences in GeneBank are usually shorter than original trace files
  • there is no way you can detect a sequencing error in plain text/fasta file without looking at the trace file

To get them one can search for relevant trace files using Sanger’s Trace server:

http://trace.ensembl.org/cgi-bin/tracesearch

or NCBI http://www.ncbi.nlm.nih.gov/blast/mmtrace.shtml

After blasting one can retrieve trace files as compressed tar in SCF or RCF. RCF is encoded & shrunk SCF: obtain and compile the rcf2scf program here if you plan to get a large number of trace files for speeding up transfer times.

Genome-based

  • based on homology
  • de novo

This will be covered in the genome annotation guide.

 

 This article is a stub. You can help OpenWetWare by expanding it.

FBA (Flux Balance Analysis)-PDF

zhourui
-
0

Flux Balance Analysis

FBA has been shown to be a very useful technique for analysis of metabolic capabilities of cellular systems. FBA involves carrying out a steady state analysis, using the stoichiometric matrix for the system in question. The system is assumed to be optimised with respect to functions such as maximisation of biomass production or minimisation of nutrient utilisation, following which it is solved to obtain a steady state flux distribution. This flux distribution is then used to interpret the metabolic capabilities of the system. The dynamic mass balance of the metabolic system is described using the stoichiometric matrix, relating the flux rates of enzymatic reactions, [math]\displaystyle{ \mathbf{v}_{n\times 1} }[/math] to time derivatives of metabolite concentrations, [math]\displaystyle{ \mathbf{x}_{m\times 1} }[/math] as

[math]\displaystyle{ \frac{d\mathbf{x}}{dt} = \mathbf{S}\,\mathbf{v} }[/math]

[math]\displaystyle{ \mathbf{v}=[v_1 \ v_2 \ … \ v_{n}\ b_1\ b_2\ …\ b_{n_{ext}} ]^T }[/math]

where [math]\displaystyle{ v_i }[/math] signifies the internal fluxes, [math]\displaystyle{ b_i }[/math] represents the exchange fluxes in the system and [math]\displaystyle{ n_{ext} }[/math] is the number of external metabolites in the system. At steady state,

[math]\displaystyle{ \frac{d\mathbf{x}}{dt} = \mathbf{S}\,\mathbf{v} = 0 }[/math]

Therefore, the required flux distribution belongs to the null space of [math]\displaystyle{ \mathbf{S} }[/math] . Since [math]\displaystyle{ m \lt n }[/math] , the system is under-determined and may be solved for [math]\displaystyle{ \mathbf{v} }[/math] fixing an optimisation criterion, following which, the system translates into a linear programming problem:

[math]\displaystyle{ \min_{\mathbf{v}}\ \mathbf{c}^T\mathbf{v} \qquad \textrm{s. t.} \quad \mathbf{S}\,\mathbf{v}=0 }[/math]

where [math]\displaystyle{ c }[/math] represents the objective function composition, in terms of the fluxes. Further, we can constrain:

[math]\displaystyle{ 0 \lt v_i \lt \infty }[/math]

[math]\displaystyle{ -\infty \lt b_i \lt \infty }[/math]

which necessitates all internal irreversible reactions to have a flux in the positive direction and allows exchange fluxes to be in either direction. Practically, a finite upper bound can be imposed, so that the problem does not become unbounded. This upper bound may also be decided based on the knowledge of cellular physiology.

Perturbations

FBA also has the capabilities to address effect of gene deletions and other types of perturbations on the system. Gene deletion studies can be performed by constraining the reaction flux(es) corresponding to the gene(s) (and therefore, of their corresponding proteins(s)), to zero. Effects of inhibitors of particular proteins can also be studied in a similar way, by constraining the upper bounds of their fluxes to any defined fraction of the normal flux, corresponding to the extents of inhibition.

 

References

  • Bonarius HPJ, Schmid G, Tramper J (1997) Flux analysis of underdetermined metabolic networks: The quest for the missing constraints. Trends Biotech 15: 308–314.
  • Forster J, Famili I, Fu P, Palsson BO, Nielsen J (2003) Genome-scale reconstruction of the Saccharomyces cerevisiae metabolic network. Genome Res 13: 244–253.
  • Edwards JS, Palsson BO (2000) The Escherichia coli MG1655 in silico metabolic genotype: Its definition, characteristics, and capabilities. Proc Natl Acad Sci U S A 97: 5528–5533.
  • Edwards JS, Covert M, Palsson BO (2002) Metabolic modelling of microbes: The flux-balance approach. Environ Microbiol 4: 133–133.
  • Kauffman KJ, Prakash P, Edwards JS (2003) Advances in flux balance analysis. Curr Opin Biotech 14: 491–496.
  • Alvarez-Vasquez F, Sims K, Cowart L, Okamoto Y, Voit E, et al. (2005) Simulation and validation of modelled sphingolipid metabolism in Saccharomyces cerevisiae. Nature 433: 425–430.
  • Edwards JS, Ibarra RU, Palsson BO (2001) In silico predictions of Escherichia coli metabolic capabilities are consistent with experimental data. Nat Biotechnol 19: 125–130.
  • Raman K, Rajagopalan P, Chandra N (2005) Flux Balance Analysis of Mycolic Acid Pathway: Targets for Anti-Tubercular Drugs. PLoS Comput Biol 1(5): e46

MoMA (Minimisation of Metabolic Adjustment)-PDF

zhourui
-
0

Minimization of Metabolic Adjustment

MoMA is a flux-based analysis technique similar to FBA and based on the same stoichiometric constraints, but the optimal growth flux for mutants is relaxed. Instead, MoMA provides an approximate solution for a sub-optimal growth flux state, which is nearest in flux distribution to the unperturbed state. The mathematical formulation of this yields a quadratic programming problem:

[math]\displaystyle{ \min\ ||\mathbf{v_w} – \mathbf{v_d}||^2 \qquad s. t.\quad \mathbf{S}\cdot\mathbf{v_d}=0 }[/math]

where [math]\displaystyle{ \mathbf{v_w} }[/math] represents the wild-type (or unperturbed state) flux distribution and [math]\displaystyle{ \mathbf{v_d} }[/math] represents the flux distribution on gene deletion that is to be solved for. This simplifies to:

[math]\displaystyle{ \min\ \frac{1}{2}\,{\mathbf{v_d}}^T\,\mathbf{I}\,\mathbf{v_d} + (\mathbf{-v_w})\cdot\mathbf{v_d} \qquad s. t.\quad \mathbf{S}\cdot\mathbf{v_d}=0 }[/math]

where [math]\displaystyle{ \mathbf{I} }[/math] is an identity matrix of size [math]\displaystyle{ n \times n }[/math], [math]\displaystyle{ n }[/math] being the length of the vector [math]\displaystyle{ \mathbf{v_d} }[/math]. An important feature of MoMA is that the wild-type flux distribution used need not be obtained by performing an FBA; an experimentally determined flux distribution could serve better. Thus, objective functions for optimisation, which may not reflect the physiological situation very accurately can be circumvented using MoMA. MoMA also does not assume optimality of growth or any other metabolic function.

References

  • Segre D, Vitkup D, Church GM. Analysis of optimality in natural and perturbed metabolic networks. Proc Natl Acad Sci U S A 2002; 99:15112–15117.
  • Segre D, Zucker J, Katz J, et al. From annotated genomes to metabolic flux models and kinetic parameter fitting. OMICS 2003; 7:301–316.

PCR-PDF

zhourui
-
0

Primer design for PCR

  • General Design considerations. Make sure that:
    • The primer length is between 15-30 bp. I suggest starting with 20-25 bp primers.
    • The Tm of each primer is between 55-65 °C
    • The GC content of each primer is between 40-60%
    • The Tm of both primers are very similar, i.e., within ~2 °C
    • The GC content of both primers are very similar, i.e., within ~5 %
    • Either primer will not form a stable internal hairpin structure, i.e., ΔG <-3 kcal/mol
    • Either primer will not form a stable dimer with itself, i.e., ΔG <-3 kcal/mol
    • The forward and reverse primers do not combine to form a stable hairpin structure or dimer
    • If possible the 3′ end of each primer should end with a GC
  • BioBrick Parts
    • Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
    • I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
    • The Biobrick part starts with a start codon (ATG) and ends with two consecutive stop codons (TAATAA).
Then the forward primer should be of the form

5′
CCTT
TCTAGAG (15-20 bp of the coding strand, starting ATG) 3′
and the reverse primer should be of the form:

5′
AAGG
CTGCAGCGGCCGCTACTAGTA (15-20 bp reverse complement, starting TTATTA) 3′
Here there are a four nucleotides (in italics) flanking the restriction sites (in bold); such spacers are required to allow the restriction enzymes to cut properly.
  • BioFusion Parts
    • Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
    • I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
    • The insert for the forward primer does not begin with TC (or else a DAM I site (GATC) is formed, and XbaI cannot cut).
    • The Biofusion construction does not begin with a start codon, nor does it end with a stop codon.
Then, the forward primer should be of the form:

5′
CCTT
TCTAGA (15-20 bp of the coding strand) 3′
and the reverse primer should be of the form:

5′
AAGG
CTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3′
Here there are a four nucleotides (in italics) flanking the restriction sites (in bold); such spacers are required to allow the restriction enzymes to cut properly.
    • Note: if it is not possible to make a good set of primers with the flanking regions described above, try changing the first 4 bases – which are external to the restriction site – of each primer, e.g.
      5′ AAGGTCTAGA (15-20 bp of the coding strand) 3′
    • Note: if you are still not able to get a good set of primers, try using a completely different set of flanking regions to improve the primers. For example, you can also use a PCR product that has the EcoRI, NotI, and XbaI sites upstream of your part, while the SpeI site is downstream of your part. In this case, the forward primer would be of the form: 5′ CCTTGAATTCGCGGCCGCATCTAGA (15-20 bp complement to coding strand)3′ and the reverse primer should be of the form:
      5′ AAGGACTAGT (15-20 bp complement to coding strand) 3′.
  • If you are installing restriction sites at the ends of the pcr product so that the pcr fragment can be digested and ligated into a plasmid
    • ensure that the amplified region does not include the restriction enzymes which you will digest with in your next step.
    • include a few nucleotides followed by your restriction sites as 5’flanking regions (regions which are at the 5′ primer end, but are not complementary to the template) to your primer.

Designing Primers Using Vector NTI

An easy way to design primers is to use Vector NTI.

  1. Find the genomic DNA sequence that you want to amplify as your part at yeastgenome.org or PubMed and save it into Vector NTI.
  2. Highlight the sequence that you want as your part, and select Analyses -> Primer Design -> Amplify Selection.
  3. Under the Primer tab, set “Before” and “After” to 0 bp. Adjust the Tm, primer length, GC content, et c. as noted above. Also click More>> and insert the flanking sense and anti-sense sequences (given at top) in the boxes “Attach to 5′ terminus of Sense primer” and “Attach to 5′ terminus of Anti-sense primer”. Lastly, click “Apply” then “OK.”
  4. Three possible sets of designed primers will appear in a folder on the left side of the screen, ranked by their score. Usually, the best possible score is 171. The lowest score that I (Caroline) have successfully used is ~110.
  5. If the score is poor, look at the individual primer attributes to determine why this is and adjust the input conditions appropriately.
    • If the two primers have very different GC content, try altering the flanking sequences to equalize the GC content.
    • If the Tm is low, increase the minimum and maximum length of the primers. Vector NTI typically does not scan all possible primer lengths; this forces it to search longer lengths.
  6. Double-check your primers for hairpins & dimers by highlighting a given sequence, then right-clicking and selecting “Analyze”.
    • For more information, check out Vector NTI’s user manual, Chapters 8 and 20.
  • Order 25 nmol DNA oligo with standard desalting from IDT.

PCR from genomic DNA or a plasmid template

Both are known to work. My two cents (Caroline): Using Vent (condition A) works for most (>90%) parts. However, there have been few parts for which I couldn’t get pcr products using condition A. I have been able to pcr out these difficult parts using Pfx (condition B) — Pfx has worked for *all* pcr reactions I’ve tried.

Condition A: Vent polymerase

Materials Required

  • 10x ThermoPol buffer
  • Vent DNA polymerase
  • 25 mM dNTPs
  • template DNA
  • 100 µM forward primer
  • 100 µM reverse primer

Procedure

  1. Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
  2. Mix, adding the enzyme last:
    • 5 µL 10x ThermoPol buffer
    • 0.4 µL 25 mM dNTPs
    • 0.5 µL 100 µM forward primer
    • 0.5 µL 100 µM reverse primer
    • ≤1 µL plasmid DNA or 2 µL genomic DNA
    • 1 µL Vent DNA polymerase
    • distilled water to 50 µL total volume
  3. PCR program:
    • Start: 95 °C for 2 min. (melt)
    • Cycle 95 °C for 0.5 min (melt)
    • Tm minus 5 °C for 0.5 min. (anneal)
    • 74 °C for (# bp/1000) min. (extension) – no less than 0.5 min.
    • No. of Cycles: 30
    • End: keep at 4 °C forever

Condition B: Pfx Polymerase

Materials Required

  • Platinum Pfx polymerase (Invitrogen catalog #11708-013)
  • 10 mM dNTPs in water (this means [dATP]=[dCTP]=[dGTP]=[dTTP]=10 mM
  • template DNA
  • 100 μM forward primer in water
  • 100 μM reverse primer in water

Procedure

  1. Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
  2. Mix, adding the enzyme last:
    • 3 µL primer mix (10µM of each primer)
      • I typically make this primer mix by adding 1 µL of the 100 µM forward primer, 1 µL of the 100 uM forward primer, and 8 µL of sterile water.
    • 0.8 µL template DNA
    • 25 µL 10X PFx amplification buffer
    • 3 µL 10mM dNTPs (each dNTP is 10 mM)
    • 2 µL 50mM MgSO4
    • 30 µL 10X PFx enhancer buffer
    • 34.2 µL water (to 100 µL)
    • 2 µL PFx DNA polymerase
  3. PCR Program
    • Start: 94 °C for 5 min. (melt)
    • Cycle 94 °C for 15 sec (melt) (cycle start)
    • 55 °C for 0.5 min. (anneal)
      • 55 °C is a suggested annealing temperature. However, VectorNTI will suggest an annealing temperature (TaOpt) when it generates a primer set.
      • If you have a series of pcr reactions, use the lowest annealing temperature of the group.
    • 68 °C for 1 min/kb (no less than 0.5 min) (extension)
    • 68 °C for 7 min (cycle end)
    • No. of Cycles: 35
    • End: keep at 4 °C forever

C. Optional: Restriction Digest

  • If you are going to digest your PCR product for ligation into a plasmid, I recommend doing the digestion before doing gel analysis. Doing the digest before the gel analysis will not allow you to identify cut vs. uncut DNA (typically this is only a few bp difference), but it will allow you to exclude any spurious PCR products that contain those restriction sites.
  • See the restriction digest page for a detailed procedure of digesting PCR products.

D. Gel analysis and purification of PCR products

  • Run the (digested) PCR reaction on an appropriate percentage agarose gel.
  • Image the gel, and identify the bands of interest.
  • Cut out the band of interest.
    • Wear a lab coat, gloves, and UV-protective googles to avoid accidental UV exposure, i.e. a bad sunburn.
    • If using the Chemi Doc, slide out the UV transilluminator completely & insert the plexiglass protective shield in the holder at the front of the tray.
    • Using a disposable scalpel, cut as small a piece of gel as possible that contains the central DNA band region. Be conservative.
    • Using tweezers, place the gel pieces into labeled tubes.
  • Image the gel after you cut and remove the bands. This image documents that you cut out the correct band.
  • Gel extract the DNA using Qiagen’s PCR purification kit. Use the instructions for gel purification, and elute with 30 µL.
    • If you end up with a reasonable chunk of gel, measure its weight in advance of doing the purification, and follow the guidelines for how much buffer to dissolve the gel in. If you do not, agarose (we suspect) can end up precipitating in your ‘purified’ DNA.
  • Measure the A260/A280 ratio of your purified DNA. It should be ~1.5 . If it is ~1.0, re-purify the DNA by doing an additional PCR purification.

E. Colony PCR

Colony PCR is useful when you are doing genomic mutations but don’t want to take the day to isolate the genome. It has worked well with Pfx DNA Polymerase.

  1. Pick colonies
    1. Pick colonies with a pipette tip and resuspend in 20 μl of cold ddH2O by pipetting up and down
    2. Pipette 3μl onto an index plate with appropriate antibiotic for use later if colony is good.
    • CAREFUL! Do if you go to the second plunge with the pipette tip, it will spatter and you can get contaminant cells!
    1. Grow index plate at 37°C o/n.
  2. Make master mix:…………..20 μl/rxn
    1. 10x PCR buffer……….5.0
    2. 10mM dNTPs…………0.6
    3. 50mM Mg2SO4……….0.4
    4. 10x enhancer…………6.0
    5. ddH2O…………………3.0
    • Note: mix together {n+1} volumes of each substrate, where n=the number of reactions you will be doing.
    • Note: these volumes are for 20uL reactions. Adjust if using lower volumes.
  3. Make 10μM primer mix:
    1. Mix 2μL of both primers (100μM stock) into 18μL ddH2O.
    2. If you need more than 20μL of primer, adjust volumes. (1μL of each per total 10μL mix)
  4. For each 20 μl reaction, mix together in PCR tube.
    1. 15μL Master Mix
    2. 2.0μL Colony suspension (template)
    3. 2.0μL Primer mix (10μM each primer)
    4. 1.0μL Pfx Platinum DNA Pol
  5. Program cycle in PCR thermocycler with steps 2-4 repeating 34 times.
    1. 94°C at 5:00 (m:s)
    2. 94°C at 0:15
    3. 55°C at 0:30
    4. 68°C at 2:00
    5. 68°C at 7:00
    6. 4°C at ∞
  6. Check products on a gel with 10μL samples (2.5μL 5xdye). Should be the same size as the PCR product from earlier. Also–run a control using the host strain with pKD46. This should result in the length of the gene(s) to be knocked out+100.

 

Annealing and primer extension with Klenow polymerase-PDF

zhourui
-
0

Overview

This protocol uses annealing and primer extension to generate a short DNA fragment (~100 bp). The DNA fragment is prepared for cloning by restriction digest.

Materials

  • Two oligos that overlap by ~20 bp and have restriction enzyme sites at the 5′ ends as in the diagram below. See restriction digest notes for information on cutting near the ends of linear DNA fragments. See notes for more information on primer ordering.

Oligo 1:    5′ —RE site——————————– 3′
Oligo 2:                                        3′ ——————————–RE site— 5′

  • Klenow 3′[math]\displaystyle{ \rightarrow }[/math]5′ exo– polymerase
  • dNTPs (25 mM each dNTP in stock)
  • Restriction enzyme(s)
  • Restriction enzyme buffer
  • BSA

Calculating amount of oligo for reaction

[math]\displaystyle{ \rm{X\ L\ oligo} = \frac{\frac{Y\ g\ oligo}{(330\ g/mol\ of\ nt)(W\ nt/oligo)}\ mol\ of\ oligo}{Z\ mol/L\ oligo\ stock} }[/math]

Procedure

  1. Dilute the two oligos to a concentration of 10 or 25 μM using H2O
  2. Mix the following in a 0.6 mL sterile tube
    • 10 μL 10X restriction enzyme buffer
    • 1 μL 100X BSA
    • X μL oligo 1 (typically 1 μg or more)
    • Y μL oligo 2 (typically 1 μg or more)
    • (87 – X – Y) μL deionized sterile H2O
  3. Anneal the two oligos together by either placing the mixture in a thermal cycler (MJ Research, PTC-200) at 94°C for 5 mins, cooling down for 0.1°C/sec to 5°C below the melting temperature of the primers, hold that temperature for 5 mins, then cool down at 0.1°C/sec to 37°C. Alternatively, the tube can be placed in a beaker of boiling water and let cool to room temperature.
  4. Add 1 μL Klenow 3′[math]\displaystyle{ \rightarrow }[/math]5′ exo– polymerase to mixture.
    Vortex polymerase before pipetting to ensure it is well-mixed.
  5. Add 1 μL dNTPS (equal to 0.25 mM final concentration of each dNTP).
    Recommend using a thermal cycler for the following incubation steps.
  6. Incubate for 1 hr at 37°C.
  7. Heat inactivate polymerase by incubating at 75°C for 20 minutes. This inactivation temperature might be higher than the melting temperature of your annealed and extended primers. It may be prudent to ramp the temperature down from 75°C.
    See Restriction Digest for more information on the following steps.
  8. Add 1 μL restriction enzyme(s) to mixture.
  9. Incubate for a minimum of 2 hrs.
  10. Heat inactivate restriction enzyme by incubating at 80°C for 20 mins.
  11. Purify DNA as necessary

Notes

  • For oligos greater than 50-60 bp in length, there can often be problems with errors or deletions in the primers. Therefore, it might be worth ordering your primers with an extra purification step such as PAGE. Invitrogen custom primers offer this service for an extra fee.
  • Klenow is tolerant of a broad range of buffer conditions. This includes NEBuffer for EcoRI in which it will exhibit a rate of polymerization of approximately equal to 50% of that in its recommended buffer. For greater reproducibility, you could add DTT to the reaction, since DTT is absent from the EcoRI reaction buffer. Courtesy of Paul Walsh at NEB Technical Support.
  • When using Klenow(exo-) for this type of reaction, there is much less risk of “overdoing” the reaction than when using regular Klenow. Incubating at 37C for one hour, using one unit of Klenow(exo-) per pmol of DNA should result in the desired 90bp duplex. Courtesy of Paul Walsh at NEB Technical Support.
  • The Klenow (exo-) polymerase will exhibit >75% activity at 25°C, compared to 100% at 37°C. Courtesy of Chris Benoit at NEB Technical Support.
  • If you are annealing two oligos with a region of complementarity on each end generating an annealed, fully extended product in the 100 bp range, I recommend 5U of Klenow(exo-) per microgram of the primed template. Courtesy of Chris Benoit at NEB Technical Support.
  • Reshma 19:50, 19 October 2006 (EDT): Tom Knight suggests considering how much enzyme you use relative to how much primer. Supposedly, polymerase does not necessarily fall off the ends of the DNA which means in 2-3 cycles, very few of your annealed primers will become completely double-stranded (as this requires two polymerases to bind to the same annealed primer molecule and extend). This lack of complete double-stranding could increase the potential for errors.

References

  1. Stemmer WP, Crameri A, Ha KD, Brennan TM, and Heyneker HL. Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene. 1995 Oct 16;164(1):49-53. DOI:10.1016/0378-1119(95)00511-4 | PubMed ID:7590320 | HubMed [Stemmer-Gene-1995]

DNA Precipitation-PDF

zhourui
-
0
DNA Precipitation-PDF

Overview

This protocol can be used to concentrate DNA or to change the buffer the DNA is suspended in. It can also be coupled with phenol-chloroform extraction for purifying nucleic acids. This protocol also works for RNA precipitation (take care to use RNAse free materials in this case).

Materials

  • 3M NaOAc pH 5.2
  • EtOH 95%
  • Glycogen (optional)

Procedure

  1. Add 0.1 volume of 3M Sodium Acetate solution to 1 volume of DNA sample.
  2. Add 1ul Glycogen to the DNA sample.
  3. Add 2 volumes of 95% EtOH to the DNA Sample.
  4. Store the solution overnight at -20°C or for 30 minutes at -80°C.
  5. Centrifuge the solution at maximum speed for at least 15 minutes.
  6. Decant and discard the supernatant.
  7. (Optional) Add 1 ml of 70% EtOH to the pellet and let sit for 5 minutes.
  8. (Optional) Centrifuge the sample at maximum speed for 5 minutes.
  9. (Optional) Decant and Discard the supernatant.
  10. Air-dry the pellet for 10-15 minutes at room temperature until all liquid is gone.
  11. Resuspend in the desired volume of water or buffer

Notes

  • Ryan R Hurtado 17:21, 22 April 2008 (EDT):

-20°C for an hour is fine for using larger (1mL of bacterial culture, plasmid) amounts of DNA

The DNA pellet will not always be visible depending on how much DNA you are precipitating. So always take care in loading your samples in the centrifuge to remember the direction they are facing. The DNA pellet will be on the part of the tube facing the outside of the centrifuge.

This protocol will precipitate all nucleic acids, not just DNA. If you do not want RNA in your sample, one of the many ways to deal with it is to simply resuspend in TE + RNAse at the last step and leave it at room temperature for 15mins-1hr.

BioCoder version

Following is the DNA Precipitation protocol in BioCoder, a high-level programming language for expressing biology protocols. What you see here is the auto-generated text output of the protocol that was coded up in BioCoder (see Source code). More information about BioCoder can be found on my home page. Feel free to mail me your comments/ suggestions.

 

References

Links

 

Micropure EZ and Microcon purification-PDF

zhourui
-
0

Overview

This protocol was used to purify a DNA fragment about 80 bp in length. The fragment encoded a promoter and was generated via restriction digest. This protocol will remove enzymes and salts. It also removes species that have lower molecular weight than what the Microcon filter retains. Any DNA or RNA with higher molecular weight than what the column retains will remain in your sample. For 3A assembly, the presence of the vector fragment does not matter cause incorrect products are selected against.

Materials

  • Micropure-EZ filter
  • Microcon filter
  • Tabletop centrifuge
  • Sterile H2O

Procedure

  1. Read literature that comes with the Micropure-EZ and Microcon filter carefully. It contains a lot of useful information. It also describes how to assemble the Micropure-EZ filter on top of the Microcon filter in a vial. For an 80 bp fragment, I used the YM-30 column successfully. The remaining steps are for a YM-30 column. Other columns may require different spin speeds and times.
  2. Add entire restriction digest volume to Micropure-EZ filter.
  3. Spin 8 mins in table top centrifuge at 10,000 g. Spin at room temperature.
  4. Discard Micropure-EZ filter but keep Microcon filter. (The Micropure-EZ filter trapped the enzymes.)
  5. Discard flow-through.
  6. Add 200 μL H2O to Microcon column.
  7. Spin 8 mins in table top centrifuge at 10,000 g. Spin at room temperature.
  8. Discard flow-through.
  9. Add 200 μL H2O to Microcon column.
  10. Spin 8 mins in table top centrifuge at 10,000 g. Spin at room temperature.
    The above two wash steps remove salts from the restriction digest.
  11. Discard flow-through.
  12. Move Microcon filter to new eppendorf tube.
  13. Add 20 μL H2O to Microcon column.
  14. Invert column in tube.
    The column won’t be very stable but it should remain in place for the next step.
  15. Spin for 3 mins at 1000 g.
  16. Discard Microcon column. The liquid in the tube should contain your purified sample.

Notes

  • For a 57 bp fragment, use the above protocol except use a YM-10 microcon columns and increase the spin times from 8 mins to 30 mins.
  • If you find a large volume is being retained in the column, this is usually an indication that you loaded a lot of material in the column. It is not necessary to add 20μL of water prior to the elution spin.
  • The spin steps should be carried out at room temperature rather than 4°C otherwise longer spin times are needed for complete spin through of the sample.

Engineering BioBrick vectors from BioBrick parts/Restriction digest-PDF

zhourui
-
0

Materials

  • Restriction enzymes (EcoRI, SpeI, XbaI or PstI) from NEB
  • Bovine Serum Albumin (BSA)
  • Deionized, sterile H2O
  • 0.5-1 μg DNA
  • Sterile 0.6mL plastic tubes

Equipment

  • DNA Engine Peltier Thermal Cycler (PTC-200) from MJ Research, Inc. (now Bio-Rad Laboratories, Inc., Hercules, CA).

Digest mix

  • 1X NEB2 buffer
  • 100 μg/mL BSA
  • 1 μL BioBrick enzyme 1
  • 1 μL BioBrick enzyme 2

deionized, sterile H2O to 50 μL

Procedure

Vortex all reagents before use.

  1. Add appropriate amount of deionized H2O to sterile 0.6 mL tube
  2. Add restriction enzyme buffer.
  3. Add BSA.
  4. Add DNA.
  5. Add each enzyme.
    Also, the enzyme is in some percentage of glycerol which tends to stick to the sides of your tip. To ensure you add only 1 μL, just touch your tip to the surface of the liquid when pipetting.
  6. Incubate for 2 hours at 37°C.
  7. Incubate for 20 mins at 80°C to heat inactivate enzyme.
    This step is sufficient to inactivate even Pst I.
  8. Incubate 4°C until you pull the reaction out of the thermal cycler.

Sequencing BioBrick DNA-PDF

zhourui
-
0

Purpose

To confirm the physical DNA resulting from a BioBrick standard assembly step has the same sequence as that part in the registry, the physical DNA must be sequenced. This is done by the BioPolymers lab in the Cancer center.

Sequence Request and Sample Preparation

Materials

  • Prepped plasmid for sequencing
    • You may want to read the notes from the Biopolymers lab for optimizing your prepped DNA
  • VF2 and VR1 verification primers (10x dilution especially for sequencing reactions)
    • We have stock solutions of these primers
    • For constructs greater than 1.5kb, you’ll want more intermediate primers (can get ~800bp of reliable sequence per primer.)
  • Sterile DI water
  • 3x Sequencing Request Form

Methods

  1. Fill out the Sequencing Request WebForm
    • Write your name and e-mail, and the name of your lab
    • Give the Template ID as whatever you want (probably the part number)
    • Primer ID is usually VF2 or VR1 (or an intermediate primer)
    • Vector is whatever vector your part is on
    • Print 2 copies, bring one with your tubes to the biopolymers lab.
      • For the Endy lab, remember to leave a copy in the Complete shelf of the lab filing cabinet (in 564d).
  2. Make a 12 μL mix as specified in the top row of the Form’s Sample Prerequisite table. Basically there will be 2x the number of tubes as there are parts being sequenced (one with VF2 and one with VR1).
    • For the stock solutions, you’ll want one microliter of primer (they have been pre-diluted so this works)
    • The sequencing request form is numbered. Put each mix into a PCR tube (the sequencing center requests the use of PCR strips) and write the number from the webform on the top of the tube. Put all the small PCR tubes into a large falcon tube. Then label the side of the large eppendorf with your name, the date, Endy Lab, and the order number given by the webform.
  3. Deliver all the tubes and the form to the Bio Polymers lab in the Cancer Center. Go to the Cancer center, take the elevator to the 4th floor, take a right, it will be your 2nd-ish door on the left.
    • The Biopolymers lab is room E17-415. Inside, there is a brown fridge with a clear plastic thing attached to the front. Put your request from in the clear plastic thing and your large eppendorf tube inside the fridge. Now you get to wait for your sequencing results to come back (usually 3-4 days). Note that the Biopolymers lab is generally only open during normal business hours, Mon-Fri, 9-5.

Retrieve sequence data

Instructions for retrieving sequence data.

If you are unable to connect to the ftp server and it is mid-morning or so, then wait 10 minutes and try again. It appears as if (but has not been verified) that the Biopolymers ftp server doesn’t permit incoming connections while they are uploading sequence data to their server.

Verify sequence data

One option is to use VectorNTI to align your expected sequences with the .abi data files generated by the sequencing center via the ContigExpress module.

The registry permits blasting against the parts database with the option of only blasting against basic parts. This can be a quick way to determine whether your sequence is right or not.

There are also various programs that the sequencing center recommends listed here.

Cloning Checklist-PDF

zhourui
-
0

E. Coli Cloning Checklist

This is a rough guide to the DOs and DO NOTs of cloning in E. Coli. It was assembled based on problems I’ve encountered while attempting restriction digests, ligations, and PCR.

Overall Plan

  • DO create/destroy restriction sites.
    • This will allow for better verification of what you’ve done. It’s just easier to tell the difference between the number of bands than the size of bands.
  • DO plan validation digests from the beginning.
    • If you plan these while you’re choosing enzymes, you can avoid having to try to tell the difference between 1300bp and 1350bp. You can have less difference between low molecular weight fragments (~100 bp if fragments are < 1kb). However, high molecular weight fragments require large differences (sometimes more than 2 or 3 kb if <3 kb). If you can clearly tell the difference between two lenghts on your ladder, it will probably work for a digest, too.
  • DO take advantage of mutagenesis.
    • Mutagenesis is simple and reliable and can save LOTS of time. Use it to switch up restriction sites throughout the vector. But don’t forget, silent mutations aren’t always silent, they effect translation and folding kinetics, so try to make silent mutations that have similar codon bias. OpenWetWare has a good codon bias table.
  • DO NOT interfere with upstream regulatory regions.
    • Unless you mean to change them, too. Promoters have important regions about 35bp and 10bp before the start codon. And don’t forget about the Shine-Dalgarno sequence (consensus in E. Coli: AGGAGGA) which is needed for mRNA to find the ribosome.
  • DO gel purify after restriction reactions.
    • You’ll lose more DNA than with a PCR cleanup kit, but you’re more likely to get what you want if you get rid of the DNA pieces you don’t want.
  • DO NOT change the reading frame of the protein.
    • Make sure to translate your final product before ordering any primers. This will make sure you kept the right reading frame throughout your construct.

Choosing Restriction Enzymes

  • DO check for enzyme uniqueness in both the backbone and insert DNA.
    • It’s simple, but a terrible thing if you forget to… Restriction sites can be created/destroyed before cloning by mutagenesis.
  • DO NOT create blunt ends.
    • Technically they work. Practically, not so well… Cloning will go much smoother with sticky ends, so avoid blunt ends if possible. Even doing a mutation to add a sticky restriction site will probably save you time.
  • DO use enzymes with different sticky ends.
    • This will allow you to make sure your DNA ends up in the vector in the right direction. It will also not allow the backbone to close on itself (can be fixed by dephosphorlyating the 5′ end of the backbone).
  • DO check for methylation sites.
    • dam methyltransferase: GA*TC
    • dcm methyltransferase: CC*AGG, CC*TGG
    • Methylation inhibits restriction enzymes. NEB lists dam or dcm sensitivity for each of their enzymes. If your enzyme is on this list, make sure there is no overlapping methylation site. If there is, fix it by mutagenesis or do your cloning in dam-/dcm- E. Coli strains (sold by NEB).

PCR

  • DO include 8-10 random nucleotides between the end of the PCR fragment and a restriction site.
    • Restriction enzymes need DNA to ‘sit’ on so that they can cut. If the restriction site is too close to the end, the enzyme will fall off the DNA before it’s enzymatic activity can occur. My favorite filler is CATGTAGC.
  • DO make sure your primer’s 3′ nucleotide is G or C.
    • G and C bind tighter than A and T. Ending with G/C gives the polymerase a good base to start polymerization.
  • DO NOT make the primer too G/C rich.
    • This will make the primer ‘sticky’ and lots of nonspecific binding/polymerization will occur. 50% is a good G/C target. This is especially important at the 3′ end of the molecule.
  • DO make sure your primers have similar [math]\displaystyle{ T_m }[/math]s.
    • They should be within 5°C of each other. Set your PCR annealing temperature to 5°C less than your lowest [math]\displaystyle{ T_m }[/math]. Only calculate the [math]\displaystyle{ T_m }[/math] for the sections which anneal.
1...8910...27Page 9 of 27

One-stop bio-protocol library

Company

Trending

Categories

© protocolbio