Mesoplasma florum: Tn5 Transposase-PDF

Overviw

Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.

Materials

• pWH1891 plasmid (kind gift of Prof. Wolfgang Hillen)
• BL21(DE3)pLysS cells
• TEGX buffer
  • 10 mM Tris-HCl pH 7.5
  • 700 mM NaCl
  • 1 mM EDTA
  • 10% glycerol
  • 0.1% Triton X-100

• Storage buffer (Epicentre)
  • 50% glycerol
  • 50 mM Tris-HCl pH 7.5
  • 100 mM NaCl
  • 0.1 mM EDTA — our version has 5 mM EDTA, since we never want in-vitro action
  • 1 mM DTT

Protocol

• Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture overnight
  • Grow in 35 ug/ml chloramphenicol and 100 ug/ml carbenicillin
• Centrifuge and remove the supernatent to eliminate beta-lactamase from the medium.
• Inoculate 1 liter of LB/Cm/Amp culture medium with the culture and grow for 5-6 hours at 25 C until OD 0.5
• Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 3-5 hours
• Split and spin down cultures and resuspend in 80 ml cold water transferring to 50 ml centrifuge tubes
• Spin down a second time and resuspend in 2 x 5 ml cold TEGX + Roche Complete protease inhibitor
• Sonicate 3x pausing 10 minutes between sonications with the cells on ice
• Centrifuge at 4C to remove cell debris – 1 hour at 16,000 x g
• Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads)
• Wash the column with 100 ml cold TEGX buffer
• Load the cell supernatent onto the column and allow it to flow through
• Flow the supernatent past the column a second time
• Wash the column with 200 ml TEGX buffer
• Add 1 ml of 1M DTT to 20 ml of TEGX buffer
• Flow the 21 ml DTT + TEGX into the column
• Cap the column and hold at 4°C overnight
• Recover the protein with 10 ml TEGX buffer flowed through the column
• Recover a second 10 ml similarly
• Concentrate the protein by spinning in Centricon YM10
• Dilute concentrate with 40% glycerol to bring final to 50%
• Store aliquots at -80 and -20
• Dilute to final 100 ng/ul (1.8 pmol/ul) with storage buffer for use

Molarity

• Gel runs at 55 KD, approximately correct for a 450 AA protein.
• Kostner06 uses 100-500 fmol DNA + 5x excess protein, or .5 – 2.5 pmol
• 1 pmol protein = 55000 g/mol * 1e-12 mol = 55 ng
• 1 pmol transposon = 2700 * 660 * 1e-12 = 1.8 ug
• 100 fmol transposon = 180 ng

DNA binding tests

• Use constant 200 ng of DNA (dilute from 1 ug/ul stock)
• Use serial dilutions of protein starting at 8 ug/ul
  • 2x dilutions 0, 2, 1, 500, 250, 125, 62.5, 31.25, 15.6, 0 into 20ul TEGX + 200 ng/ul transposon DNA
• Incubate 30 minutes at 37
• Run on 0.8% E-Gel
• DNA mixture 10*200 ng = 2 ug DNA = 2 ul DNA into 200 ul TEGX
• Tests 3/24
  • 2 ul 116 ng/ul ME0 PCR DNA
  • 500 ng, 250, 125, 62.5, 31 ng Tpase in 20 ul final volume of storage buffer
  • incubate 1 hour 37C
  • overnight at 4C

Gel images, Goryshin00

• Fig 1, 1.8 Kb transposon reacted at 2.5 ng/ul (total 1 ug) with Tn5 transposase at 10 ng/ul (total 4 ug) in 400 ul final volume, 1 hour at 37C
  • this is about 1 pmol of DNA and 72 pmol transposase, or a 72x molar excess of transposase
  • Concentrated to 20 ul and run on a 1.2% gel
• 3.7 Kb transposon reacted at 50 ng/ul (2 ug total) with Tn5 transposase at 10 ng/ul (400 ng total) in 40 ul volume, 1 hour at 37C
  • this is 1 pmol DNA and 7.2 pmol transposase, for a 3x molar excess

Goryshin98 DNA binding and cutting tests

• 0 to 3.8 pmol (nominal 2 ul of transposase, or 200 ng) of Tn5 transposase added to 0.26 pmol (nominal 1 ug of 5700 bp plasmid) plasmid in 20 ul volume
  • done with a buffer of 100 mM potassium glutamate, 25 mM Tris-acetate pH 7.5, 10 mM Mg-acetate, 50 ug/ml BSA, 0.5 mM b-mercaptoethanol, 2 mM spermidine, 10 ug/ml tRNA
  • incubated 1 hour at 20C, diluted 2-3x and incubated a further 4 hours at 37C (nominally to dilute CHAPS in transposase storage buffer)
  • results: near linear increase of cut out fragments with transposase molar excess of 0-9x

Standard Epicentre reaction

• 1 ul DNA (100 ng/ul) in TE
• 2 ul transposase
• 1 ul glycerol
• This is:
  • about 100 fmol or less transposon DNA
  • at 100 ng/ul, this is 3.8 pmol transposase or 38x molar excess
  • 25 ng/ul final, so expect 1e4 or so transformants

To Do

• Prep new Tn5 protein (on hold, unnecessary)
• quantitate existing stock with BSA dilution and gel (done, spec readings approximately correct)
• Make storage buffer, dilute existing stock into storage buffer (done)
• run Goryshin00 style test of transposome formation (to do; initial gel unconvincing)
• Run Goryshin98 style test of transposon cutting (to do)
• Try transforming E. coli cells (done, this is what counts, compared to Epicentre enzyme is OK)

pWH1891 Sequence information

• T7 and Intein-R primers, ATG start at 45
• Truncates aa’s 1-4 from canonical sequence
• Mutations
  • E54K — improve binding to OE
  • M56A — eliminate start for C-terminal inhibitory protein
  • L372P — hyperactive mutation

>pWH1891
CCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTC GGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGT AGTAAAGCCGCCCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGG CTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGA TAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGAT GACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGG TCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGA GTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAA CGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGG AGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTA TACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATG GTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCCGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGG AACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGC AGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGT TGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCGGGTGCTTTGCCAAGGGTACCAATGTTT
TAATGGCGGATGGGTCTATGA

Testing the transposase

• Transform 50 μl of E. coli Top10 electrocompetent cells with:
  • Tn5 transposons (1 μl); plate out on Tet plates, count colonies
  • pUC19 positive control 10 pg/μl; plate out on amp plates
  • Electroporation at 2.5 KV in 2 mm gap cuvette
  • pUC19 colonies visible in six hours under the microscope
  • Tet resistant colonies are not visible at that time

Notes

• Davies00 uses 100 mM hydroxylamine as a cleavage reagent instead of DTT