PCR-PDF

Primer design for PCR

• General Design considerations. Make sure that:
  • The primer length is between 15-30 bp. I suggest starting with 20-25 bp primers.
  • The T_m of each primer is between 55-65 °C
  • The GC content of each primer is between 40-60%
  • The T_m of both primers are very similar, i.e., within ~2 °C
  • The GC content of both primers are very similar, i.e., within ~5 %
  • Either primer will not form a stable internal hairpin structure, i.e., ΔG <-3 kcal/mol
  • Either primer will not form a stable dimer with itself, i.e., ΔG <-3 kcal/mol
  • The forward and reverse primers do not combine to form a stable hairpin structure or dimer
  • If possible the 3′ end of each primer should end with a GC
• BioBrick Parts
  • Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
  • I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
  • The Biobrick part starts with a start codon (ATG) and ends with two consecutive stop codons (TAATAA).

Then the forward primer should be of the form

5′
CCTT
TCTAGAG (15-20 bp of the coding strand, starting ATG) 3′

and the reverse primer should be of the form:

5′
AAGG
CTGCAGCGGCCGCTACTAGTA (15-20 bp reverse complement, starting TTATTA) 3′

Here there are a four nucleotides (in italics) flanking the restriction sites (in bold); such spacers are required to allow the restriction enzymes to cut properly.

• BioFusion Parts
  • Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
  • I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
  • The insert for the forward primer does not begin with TC (or else a DAM I site (GATC) is formed, and XbaI cannot cut).
  • The Biofusion construction does not begin with a start codon, nor does it end with a stop codon.

Then, the forward primer should be of the form:

5′
CCTT
TCTAGA (15-20 bp of the coding strand) 3′

and the reverse primer should be of the form:

5′
AAGG
CTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3′

Here there are a four nucleotides (in italics) flanking the restriction sites (in bold); such spacers are required to allow the restriction enzymes to cut properly.

• • Note: if it is not possible to make a good set of primers with the flanking regions described above, try changing the first 4 bases – which are external to the restriction site – of each primer, e.g.
    5′ AAGGTCTAGA (15-20 bp of the coding strand) 3′
  • Note: if you are still not able to get a good set of primers, try using a completely different set of flanking regions to improve the primers. For example, you can also use a PCR product that has the EcoRI, NotI, and XbaI sites upstream of your part, while the SpeI site is downstream of your part. In this case, the forward primer would be of the form: 5′ CCTTGAATTCGCGGCCGCATCTAGA (15-20 bp complement to coding strand)3′ and the reverse primer should be of the form:
    5′ AAGGACTAGT (15-20 bp complement to coding strand) 3′.
• If you are installing restriction sites at the ends of the pcr product so that the pcr fragment can be digested and ligated into a plasmid
  • ensure that the amplified region does not include the restriction enzymes which you will digest with in your next step.
  • include a few nucleotides followed by your restriction sites as 5’flanking regions (regions which are at the 5′ primer end, but are not complementary to the template) to your primer.

Designing Primers Using Vector NTI

An easy way to design primers is to use Vector NTI.

1. Find the genomic DNA sequence that you want to amplify as your part at yeastgenome.org or PubMed and save it into Vector NTI.
2. Highlight the sequence that you want as your part, and select Analyses -> Primer Design -> Amplify Selection.
3. Under the Primer tab, set “Before” and “After” to 0 bp. Adjust the T_m, primer length, GC content, et c. as noted above. Also click More>> and insert the flanking sense and anti-sense sequences (given at top) in the boxes “Attach to 5′ terminus of Sense primer” and “Attach to 5′ terminus of Anti-sense primer”. Lastly, click “Apply” then “OK.”
4. Three possible sets of designed primers will appear in a folder on the left side of the screen, ranked by their score. Usually, the best possible score is 171. The lowest score that I (Caroline) have successfully used is ~110.
5. If the score is poor, look at the individual primer attributes to determine why this is and adjust the input conditions appropriately.
   • If the two primers have very different GC content, try altering the flanking sequences to equalize the GC content.
   • If the T_m is low, increase the minimum and maximum length of the primers. Vector NTI typically does not scan all possible primer lengths; this forces it to search longer lengths.
6. Double-check your primers for hairpins & dimers by highlighting a given sequence, then right-clicking and selecting “Analyze”.
   • For more information, check out Vector NTI’s user manual, Chapters 8 and 20.

• Order 25 nmol DNA oligo with standard desalting from IDT.

PCR from genomic DNA or a plasmid template

Both are known to work. My two cents (Caroline): Using Vent (condition A) works for most (>90%) parts. However, there have been few parts for which I couldn’t get pcr products using condition A. I have been able to pcr out these difficult parts using Pfx (condition B) — Pfx has worked for *all* pcr reactions I’ve tried.

Condition A: Vent polymerase

Materials Required

• 10x ThermoPol buffer
• Vent DNA polymerase
• 25 mM dNTPs
• template DNA
• 100 µM forward primer
• 100 µM reverse primer

Procedure

1. Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
2. Mix, adding the enzyme last:
   • 5 µL 10x ThermoPol buffer
   • 0.4 µL 25 mM dNTPs
   • 0.5 µL 100 µM forward primer
   • 0.5 µL 100 µM reverse primer
   • ≤1 µL plasmid DNA or 2 µL genomic DNA
   • 1 µL Vent DNA polymerase
   • distilled water to 50 µL total volume
3. PCR program:
   • Start: 95 °C for 2 min. (melt)
   • Cycle 95 °C for 0.5 min (melt)
   • Tm minus 5 °C for 0.5 min. (anneal)
   • 74 °C for (# bp/1000) min. (extension) – no less than 0.5 min.
   • No. of Cycles: 30
   • End: keep at 4 °C forever

Condition B: Pfx Polymerase

Materials Required

• Platinum Pfx polymerase (Invitrogen catalog #11708-013)
• 10 mM dNTPs in water (this means [dATP]=[dCTP]=[dGTP]=[dTTP]=10 mM
• template DNA
• 100 μM forward primer in water
• 100 μM reverse primer in water

Procedure

1. Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
2. Mix, adding the enzyme last:
   • 3 µL primer mix (10µM of each primer)
     • I typically make this primer mix by adding 1 µL of the 100 µM forward primer, 1 µL of the 100 uM forward primer, and 8 µL of sterile water.
   • 0.8 µL template DNA
   • 25 µL 10X PFx amplification buffer
   • 3 µL 10mM dNTPs (each dNTP is 10 mM)
   • 2 µL 50mM MgSO₄
   • 30 µL 10X PFx enhancer buffer
   • 34.2 µL water (to 100 µL)
   • 2 µL PFx DNA polymerase
3. PCR Program
   • Start: 94 °C for 5 min. (melt)
   • Cycle 94 °C for 15 sec (melt) (cycle start)
   • 55 °C for 0.5 min. (anneal)
     • 55 °C is a suggested annealing temperature. However, VectorNTI will suggest an annealing temperature (TaOpt) when it generates a primer set.
     • If you have a series of pcr reactions, use the lowest annealing temperature of the group.
   • 68 °C for 1 min/kb (no less than 0.5 min) (extension)
   • 68 °C for 7 min (cycle end)
   • No. of Cycles: 35
   • End: keep at 4 °C forever

C. Optional: Restriction Digest

• If you are going to digest your PCR product for ligation into a plasmid, I recommend doing the digestion before doing gel analysis. Doing the digest before the gel analysis will not allow you to identify cut vs. uncut DNA (typically this is only a few bp difference), but it will allow you to exclude any spurious PCR products that contain those restriction sites.
• See the restriction digest page for a detailed procedure of digesting PCR products.

D. Gel analysis and purification of PCR products

• Run the (digested) PCR reaction on an appropriate percentage agarose gel.
• Image the gel, and identify the bands of interest.
• Cut out the band of interest.
  • Wear a lab coat, gloves, and UV-protective googles to avoid accidental UV exposure, i.e. a bad sunburn.
  • If using the Chemi Doc, slide out the UV transilluminator completely & insert the plexiglass protective shield in the holder at the front of the tray.
  • Using a disposable scalpel, cut as small a piece of gel as possible that contains the central DNA band region. Be conservative.
  • Using tweezers, place the gel pieces into labeled tubes.
• Image the gel after you cut and remove the bands. This image documents that you cut out the correct band.
• Gel extract the DNA using Qiagen’s PCR purification kit. Use the instructions for gel purification, and elute with 30 µL.
  • If you end up with a reasonable chunk of gel, measure its weight in advance of doing the purification, and follow the guidelines for how much buffer to dissolve the gel in. If you do not, agarose (we suspect) can end up precipitating in your ‘purified’ DNA.
• Measure the A₂₆₀/A₂₈₀ ratio of your purified DNA. It should be ~1.5 . If it is ~1.0, re-purify the DNA by doing an additional PCR purification.

E. Colony PCR

Colony PCR is useful when you are doing genomic mutations but don’t want to take the day to isolate the genome. It has worked well with Pfx DNA Polymerase.

1. Pick colonies
   1. Pick colonies with a pipette tip and resuspend in 20 μl of cold ddH₂O by pipetting up and down
   2. Pipette 3μl onto an index plate with appropriate antibiotic for use later if colony is good.

   • CAREFUL! Do if you go to the second plunge with the pipette tip, it will spatter and you can get contaminant cells!

   1. Grow index plate at 37°C o/n.
2. Make master mix:…………..20 μl/rxn
   1. 10x PCR buffer……….5.0
   2. 10mM dNTPs…………0.6
   3. 50mM Mg₂SO₄……….0.4
   4. 10x enhancer…………6.0
   5. ddH₂O…………………3.0
   • Note: mix together {n+1} volumes of each substrate, where n=the number of reactions you will be doing.
   • Note: these volumes are for 20uL reactions. Adjust if using lower volumes.
3. Make 10μM primer mix:
   1. Mix 2μL of both primers (100μM stock) into 18μL ddH₂O.
   2. If you need more than 20μL of primer, adjust volumes. (1μL of each per total 10μL mix)
4. For each 20 μl reaction, mix together in PCR tube.
   1. 15μL Master Mix
   2. 2.0μL Colony suspension (template)
   3. 2.0μL Primer mix (10μM each primer)
   4. 1.0μL Pfx Platinum DNA Pol
5. Program cycle in PCR thermocycler with steps 2-4 repeating 34 times.
   1. 94°C at 5:00 (m:s)
   2. 94°C at 0:15
   3. 55°C at 0:30
   4. 68°C at 2:00
   5. 68°C at 7:00
   6. 4°C at ∞
6. Check products on a gel with 10μL samples (2.5μL 5xdye). Should be the same size as the PCR product from earlier. Also–run a control using the host strain with pKD46. This should result in the length of the gene(s) to be knocked out+100.